ID: 906057858

View in Genome Browser
Species Human (GRCh38)
Location 1:42930288-42930310
Sequence GCTGCTACTCTGCCACAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 164}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906057856_906057858 -5 Left 906057856 1:42930270-42930292 CCAGCACAGAGAATGGGGGCTGC 0: 1
1: 0
2: 1
3: 17
4: 213
Right 906057858 1:42930288-42930310 GCTGCTACTCTGCCACAAGAGGG 0: 1
1: 0
2: 1
3: 14
4: 164
906057851_906057858 7 Left 906057851 1:42930258-42930280 CCACAGATGTGTCCAGCACAGAG 0: 1
1: 0
2: 2
3: 32
4: 276
Right 906057858 1:42930288-42930310 GCTGCTACTCTGCCACAAGAGGG 0: 1
1: 0
2: 1
3: 14
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906057858 Original CRISPR GCTGCTACTCTGCCACAAGA GGG Intronic
905292559 1:36932402-36932424 CCTCCTACTCTGGTACAAGAGGG - Intronic
905712899 1:40121947-40121969 TCTGCTACTCAGCCATAAAAAGG - Intergenic
906057858 1:42930288-42930310 GCTGCTACTCTGCCACAAGAGGG + Intronic
910687252 1:89929915-89929937 GCTGCTGATCTGACACAAAACGG - Intronic
912420899 1:109541733-109541755 GCAGCTCCTTTCCCACAAGAGGG + Intronic
913145184 1:115981914-115981936 TGTGCTACTCTGCTGCAAGATGG + Intronic
915940545 1:160115843-160115865 TCAGCCACTCTGCCCCAAGATGG + Exonic
922690472 1:227685170-227685192 CCTGCTACTTAGGCACAAGAGGG + Intergenic
1063076206 10:2719291-2719313 TCTGCCTCCCTGCCACAAGATGG + Intergenic
1065176574 10:23082086-23082108 AATACTTCTCTGCCACAAGAGGG + Intergenic
1068671426 10:59727517-59727539 CCTGCTACTTGGGCACAAGATGG - Intronic
1070905226 10:80066181-80066203 GCTGCTTCTCTGCCTAAAGAAGG - Intergenic
1071282603 10:84116112-84116134 CCTGCTACTTGGGCACAAGATGG + Intergenic
1075398370 10:122143642-122143664 GCTTCTACTCTGTCACCAGCTGG - Exonic
1076391821 10:130109290-130109312 ACTGCTACTGTGCTACCAGATGG - Intergenic
1078470546 11:11582552-11582574 TCTTTTCCTCTGCCACAAGATGG + Intronic
1083664500 11:64267214-64267236 GCTGCTGCCCAGCCACAAGACGG - Exonic
1084233364 11:67769457-67769479 GCTGCTACTCTGGCTAAGGACGG + Intergenic
1086008473 11:82069093-82069115 GCTGCAGCTCTGCTGCAAGAAGG + Intergenic
1087684891 11:101251235-101251257 CCTGCTACTTAGGCACAAGATGG + Intergenic
1094427539 12:30330697-30330719 GCTGCTCTTCTGCTACAACAGGG - Intergenic
1098749023 12:74271976-74271998 CCTGCTACTTGGGCACAAGATGG + Intergenic
1101028140 12:100634101-100634123 CCTGCTACTTGGACACAAGACGG - Intergenic
1101957402 12:109223210-109223232 GCCGCGACTCAGCCACAGGAGGG - Intronic
1103152057 12:118649391-118649413 GCTGCTATGCTGACAGAAGAGGG - Intergenic
1107722847 13:43267208-43267230 GCTGCTACTCTCCCCCAGGTAGG + Intronic
1110565593 13:76954784-76954806 GCTGTTCCTCTGCCAGAGGAAGG - Intronic
1110746572 13:79060706-79060728 GCTACTACTCAGCCATAAAAAGG + Intergenic
1113668072 13:112154617-112154639 GCTTCTCATCTGCCACCAGATGG + Intergenic
1116240681 14:42338804-42338826 CCTGCTACTTGGGCACAAGATGG - Intergenic
1116494169 14:45540462-45540484 CATACTACTCAGCCACAAGATGG + Intergenic
1117447699 14:55820607-55820629 CCTGCTACTTGGACACAAGATGG - Intergenic
1118446126 14:65852619-65852641 GCTGCTGGTCTGCCTTAAGAGGG + Intergenic
1121004938 14:90484035-90484057 GCTGCTTCCCTGCCACTATAGGG - Intergenic
1121770040 14:96526304-96526326 GTACCTACTCTGCCACTAGAAGG - Intronic
1121845101 14:97165700-97165722 GATGCCACTCTGCAACTAGAAGG - Intergenic
1123494766 15:20814577-20814599 GCTGCTTCCCCGCCCCAAGAAGG + Intergenic
1123551261 15:21383670-21383692 GCTGCTTCCCCGCCCCAAGAAGG + Intergenic
1127840639 15:62828430-62828452 GCTTCTACTCTGCCTAATGAAGG - Intronic
1129371218 15:75096863-75096885 GCTGCTACTCCAGCACAGGAGGG + Intronic
1130244642 15:82234218-82234240 TCTGCTAATAAGCCACAAGATGG - Intronic
1202959602 15_KI270727v1_random:110913-110935 GCTGCTTCCCCGCCCCAAGAAGG + Intergenic
1132793665 16:1707316-1707338 GCTGCTCCTCTGTCAGCAGAAGG + Intronic
1133316181 16:4885441-4885463 GCTGGTACTCTGCCTCCAGCTGG + Exonic
1134316502 16:13123754-13123776 GCTACCACTTTGCCACAAGAAGG - Intronic
1140825860 16:78705844-78705866 TCTGGTACTTTGCCACAAGGTGG + Intronic
1145939982 17:28738127-28738149 GCTGCTCCACTGCCCCAGGAAGG - Exonic
1146764542 17:35507292-35507314 CCTGCTACTTGGGCACAAGATGG + Intronic
1147809942 17:43161308-43161330 CCTGCTACTTAGGCACAAGATGG - Intergenic
1148083125 17:44978362-44978384 GCTGCTGCTCTGCCAGAGGCTGG - Intergenic
1148958287 17:51371797-51371819 GTTGTCTCTCTGCCACAAGATGG + Intergenic
1150134929 17:62690262-62690284 GCTGCTGCTGGGCCACAAGGAGG + Exonic
1150347922 17:64418919-64418941 CCTGCTAATCTTCCACTAGATGG - Intergenic
1150692754 17:67378877-67378899 GCTGCGACGCGGCCACAGGAGGG + Intronic
1152294582 17:79459272-79459294 GCTGCTGCTCTTCCACTAGCTGG + Intronic
1153062039 18:1004769-1004791 GCTGCTATTATACCACAAGGAGG - Intergenic
1153304820 18:3622000-3622022 GCTGCTGCTTTGCCAACAGAGGG + Intronic
1154452169 18:14487098-14487120 GCTGCTTCCCCGCCCCAAGAAGG + Intergenic
1161830598 19:6601051-6601073 CCTGCTACTTAGGCACAAGATGG + Intronic
1162146563 19:8615891-8615913 ACTGCAGCTCTGCCACAGGAGGG + Intergenic
1163878446 19:19896740-19896762 CCTGCTACTTAGGCACAAGATGG + Intergenic
1164216530 19:23155581-23155603 CCTGCTACTTGGCCACAAGACGG - Intergenic
1167503268 19:49858862-49858884 GCTCCTCCTCTGCCACATCAGGG + Intronic
1167606260 19:50482412-50482434 GCTGCTCCTCTGCCAGCAGAAGG - Exonic
926491070 2:13527012-13527034 CCTGCTACTTGGGCACAAGACGG - Intergenic
932498603 2:72160305-72160327 ACTGCTTCTCTTCCAAAAGAAGG + Intergenic
933190028 2:79324241-79324263 GCTGCTACCCTGCCTCCAGGTGG - Intronic
934762754 2:96865429-96865451 GCAGCCACTCACCCACAAGAAGG + Exonic
935721112 2:105980162-105980184 CCTGCTACTTGGCCACAAGATGG - Intergenic
935970951 2:108530385-108530407 CCTGCTACTTAGGCACAAGACGG + Intergenic
936075883 2:109401626-109401648 GCTGCTGCTGTGTCCCAAGAGGG + Intronic
936419185 2:112347186-112347208 CCTGCTACTTAGGCACAAGACGG - Intergenic
939376601 2:141376085-141376107 GCTGCTACACTGCTCCAAGGAGG - Intronic
940838142 2:158548469-158548491 CCTGCTTCTCTGCAACAACAGGG - Intronic
944949366 2:204729663-204729685 AATGGTTCTCTGCCACAAGATGG - Intronic
946329157 2:219000119-219000141 GCTGCTCCGCTGCCACAGGGCGG - Intergenic
946746732 2:222853820-222853842 GCTGCTCCTCTGCCATAAAGTGG - Intergenic
947733742 2:232444476-232444498 GCTGCTACTCTGGCCCAGGAAGG - Intergenic
948573778 2:238936764-238936786 GCTGCTACACTGGACCAAGATGG - Intergenic
1169334409 20:4743706-4743728 GCAGATACTCTGCCTCAAGGGGG + Intergenic
1169908637 20:10628778-10628800 GCTGCTGCTTTGCCACTAGTTGG + Intronic
1170593108 20:17786253-17786275 GCAGCTGCTCTGTCACGAGAGGG - Intergenic
1174725907 20:52861928-52861950 CATGCTACTCTGCCACATAAAGG - Intergenic
1175503340 20:59465576-59465598 GCTTCTTCTCTGCCACTAAAGGG + Intergenic
1175513553 20:59552621-59552643 CCTGCTACTTAGGCACAAGATGG - Intergenic
1176169546 20:63690711-63690733 GCTGGGACTCTCCCCCAAGAGGG + Intronic
1176443856 21:6801202-6801224 GCTGCTTCCCCGCCCCAAGAAGG - Intergenic
1176522430 21:7834487-7834509 TTGGCTACTCTGCCACAAGTGGG - Intergenic
1176822023 21:13666241-13666263 GCTGCTTCCCTGCCCCAAGAAGG - Intergenic
1178448095 21:32663688-32663710 CCTGCTACTTGGGCACAAGATGG + Intronic
1178656450 21:34464499-34464521 TTGGCTACTCTGCCACAAGTGGG - Intergenic
1179670525 21:42943808-42943830 CCTGCTACTTAGGCACAAGACGG - Intergenic
1180218960 21:46345915-46345937 GCTGCCATTCAGCCACAAGAAGG - Intronic
1182288125 22:29259968-29259990 GCTCCTACTCTGTCTAAAGAGGG - Exonic
1183279453 22:36924208-36924230 CCTGCTGCTCTGACACAACAGGG + Intronic
951068377 3:18295431-18295453 GCTGCTGCTCTGCCACTGGGGGG - Intronic
951168310 3:19507887-19507909 GCTGCTACCTTCCCAAAAGATGG + Intronic
951248173 3:20365024-20365046 CCTGCTACTTGGGCACAAGATGG - Intergenic
953002205 3:38946185-38946207 GCTGGTGTTCAGCCACAAGAGGG + Intronic
953940147 3:47087475-47087497 GCTGCTACTCTGACAGCAGGTGG + Intronic
958490144 3:94762215-94762237 ACTACTACTCTGCCATAAAAAGG - Intergenic
959846828 3:111042567-111042589 GCTGCTGATCTGACAGAAGATGG - Intergenic
961372743 3:126441319-126441341 GCTGCTAGTGCGCCACAAGCAGG + Intronic
961604256 3:128082198-128082220 GCATCTTCTCTGCCACAAGAAGG + Intronic
962900988 3:139761365-139761387 GCTGCTACCCTTTGACAAGACGG + Intergenic
963034197 3:141011099-141011121 GCTGGTATTCAGCCGCAAGAAGG - Intergenic
963667009 3:148200701-148200723 TCTGCTATTCTGGCACAACATGG + Intergenic
964522015 3:157580277-157580299 GCTGCTACTTGGGCACAAGATGG - Intronic
964924396 3:161938035-161938057 CCTGCTACTTGGGCACAAGACGG + Intergenic
969383211 4:6821558-6821580 ACTACTACTCAGCCACAAAAAGG - Intronic
969821781 4:9726312-9726334 GCTGCTACTCTGGCTAAAGATGG - Intergenic
970237964 4:13977725-13977747 TCTGCTACTCTGCCAGCAGATGG - Intergenic
970824282 4:20253599-20253621 GCTCCTGCTCTGCCAGAGGAGGG + Exonic
974715998 4:65669632-65669654 GCTGCTACTCTGCACCTCGACGG - Exonic
977972761 4:103230389-103230411 CCTGCTACTTAGGCACAAGATGG + Intergenic
978286013 4:107077460-107077482 GCTTATAGTCTGCCACCAGATGG + Intronic
978953152 4:114585483-114585505 TCTGCTACTCTACCTCAAGCAGG + Intergenic
979723508 4:123932508-123932530 ACTACTACTCAGCCATAAGAAGG + Intergenic
980073384 4:128266623-128266645 CCTGCTACTTAGGCACAAGATGG + Intergenic
981646199 4:147001579-147001601 ACTTCTTCACTGCCACAAGACGG + Intergenic
983898338 4:173105178-173105200 CCTGCTACTTAGGCACAAGACGG + Intergenic
984059535 4:174975361-174975383 GGTTCAACTCTGCCAAAAGATGG + Exonic
984164334 4:176289265-176289287 GGTGCTAGTGTGACACAAGAGGG - Intergenic
985391647 4:189496805-189496827 TCTGCTGCTCTGCCACAAGAAGG + Intergenic
986036347 5:3943980-3944002 TCTGCTGCTCTGCCATTAGAAGG - Intergenic
986746568 5:10750116-10750138 TCTGAGTCTCTGCCACAAGACGG + Intronic
987176327 5:15314333-15314355 GATACTACTCAGCCACAAAAAGG - Intergenic
987257144 5:16167509-16167531 GCTGCAGCTCTCCCACATGAGGG + Intronic
988051799 5:26041179-26041201 GCTGCTGCACTGCCCCAAGGAGG + Intergenic
988329105 5:29811925-29811947 GCTGTCACTCAGCAACAAGATGG - Intergenic
988653515 5:33181094-33181116 TCTGCTACACTGACAGAAGAGGG - Intergenic
989072035 5:37521673-37521695 ACTACTACTCAGCCACAAAAAGG - Intronic
989950442 5:50291714-50291736 TCTGCAACAATGCCACAAGAAGG + Intergenic
990704195 5:58509431-58509453 AATGCTACTCAGCCATAAGAAGG + Intergenic
991675795 5:69088894-69088916 CCTGCTACTTGGGCACAAGATGG - Intergenic
996694532 5:126379240-126379262 GATACTACTCAGCCACAAAAAGG - Intronic
1003656900 6:8020305-8020327 GCTGCTCCTCTGCCCCTAGCTGG - Intronic
1005462310 6:26080695-26080717 CCTGCTACTTGGGCACAAGACGG + Intergenic
1007172602 6:39874526-39874548 TCTTCTACTCTGCCCCAAAATGG + Intronic
1007710217 6:43818138-43818160 GCTGCTACTATGATCCAAGAAGG + Intergenic
1009195028 6:60674127-60674149 CCTTCTACTGTGGCACAAGAGGG - Intergenic
1013026698 6:106281514-106281536 CCTGCTACTCAGCAACAAAAAGG - Intronic
1014927233 6:127287430-127287452 GCTGGTACCCTGCCTGAAGATGG - Exonic
1016435282 6:144030681-144030703 ACTGCTACTCAGCCATAAAAAGG - Intronic
1020316969 7:6912515-6912537 GCTGCTACTCTGGCTAAAGACGG + Intergenic
1021849064 7:24790323-24790345 CCTGCTACTTGGGCACAAGATGG - Intergenic
1021891969 7:25194895-25194917 GCTGCTCCCCTGCCCCAAGCTGG - Intergenic
1025773365 7:64534812-64534834 GATACTACTCAGCCATAAGAAGG + Intronic
1027517574 7:79161693-79161715 GCTGCTGCTCTGGTAAAAGAAGG + Intronic
1029486518 7:100845806-100845828 CCTGCTACTTAGACACAAGACGG + Intronic
1030643534 7:112033398-112033420 ACTGCTACTCTCCCTGAAGAGGG - Intronic
1032700503 7:134374616-134374638 GCTTCTCCACTGCCTCAAGATGG + Intergenic
1034267437 7:149788042-149788064 GCTTCTCCTGTCCCACAAGACGG + Intergenic
1038090046 8:24242273-24242295 CCTGCTACTTGGGCACAAGATGG + Intergenic
1038782813 8:30582750-30582772 CTTGCTACTGTGCCCCAAGAAGG - Intronic
1041515837 8:58697795-58697817 CCTGCTACTTAGGCACAAGATGG + Intergenic
1045844385 8:106616366-106616388 CCTGGTACTCTGCTATAAGAAGG - Intronic
1049265730 8:141666960-141666982 GCAGCTGCTCTGCCTCAGGAGGG + Intergenic
1049634373 8:143678992-143679014 CCTGCTACTTGGGCACAAGATGG + Intergenic
1052508456 9:29383605-29383627 CCTGCTACTAGGGCACAAGACGG + Intergenic
1059517651 9:114910639-114910661 GCTGGCATTCTCCCACAAGATGG - Intronic
1059609130 9:115872935-115872957 ACTACTACTCAGCCATAAGAAGG - Intergenic
1060088585 9:120722777-120722799 GCTACTACTTTGTAACAAGATGG + Intergenic
1061321022 9:129829477-129829499 TCTGCTGCTCTGCCAGCAGACGG + Exonic
1061642398 9:131969606-131969628 GCTGCTATTCTAGCCCAAGAGGG + Intronic
1062372511 9:136247374-136247396 CCTCCTACTCTGCAACTAGAAGG - Intergenic
1203525344 Un_GL000213v1:83325-83347 GCTGCTTCCCCGCCCCAAGAAGG + Intergenic
1187954070 X:24498382-24498404 GCAGCTATTCTGCCACCAGGGGG - Intronic
1190270661 X:48860722-48860744 CCTGCTACTTGGGCACAAGACGG + Intergenic
1190771615 X:53519384-53519406 CCTGCTACTTGGGCACAAGACGG + Intergenic
1191639591 X:63415658-63415680 CCTGCTACTTAGGCACAAGATGG + Intergenic
1191783877 X:64896898-64896920 CCTGCTGCTCAGCCATAAGAAGG - Intergenic
1192394244 X:70762493-70762515 GCTGCTGATCTGCCAGAAGGTGG - Intronic
1192915099 X:75643690-75643712 CCTGCTACTTAGGCACAAGATGG - Intergenic
1193070570 X:77301522-77301544 CCTGCTACTTGGACACAAGATGG + Intergenic
1193717718 X:84951408-84951430 CCTGCTACTTGGGCACAAGATGG + Intergenic
1194384764 X:93238579-93238601 CCTGCTACTTGGGCACAAGATGG + Intergenic
1195027795 X:100895534-100895556 CCTGCTGACCTGCCACAAGATGG + Intergenic
1200112935 X:153752091-153752113 GCTGCTGATCTGCCAGGAGATGG - Intergenic
1201259772 Y:12147751-12147773 CCTGCTACTTGGGCACAAGATGG - Intergenic