ID: 906061382

View in Genome Browser
Species Human (GRCh38)
Location 1:42951204-42951226
Sequence GTGGTATGAAGAAGGTGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 250}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906061382 Original CRISPR GTGGTATGAAGAAGGTGATG GGG Intronic
901256707 1:7834980-7835002 GTGGCAGGAGGAAGGTGAGGAGG + Intronic
904095901 1:27977095-27977117 CTGGTCTGAAGAAGGGTATGGGG - Intronic
904616259 1:31751772-31751794 GTGCTCTAAAGAAGGTGATTTGG - Intronic
906061382 1:42951204-42951226 GTGGTATGAAGAAGGTGATGGGG + Intronic
907357586 1:53889304-53889326 GAGGTTTGAAAGAGGTGATGGGG + Exonic
907491944 1:54814165-54814187 GTCCTATGAAGATGGTGAAGTGG + Intronic
909532390 1:76695242-76695264 GTGGTTTGCAAAAGGTGGTGAGG - Intergenic
909980097 1:82089159-82089181 GTGGCAGGAAGAAGGAAATGTGG + Intergenic
910106645 1:83638461-83638483 GTGGTGGGAAGAAGGTGGGGAGG - Intergenic
910134368 1:83949817-83949839 GTGGTATGAGGAAAGTTATATGG - Intronic
910482504 1:87674057-87674079 GAGGGATGAAGATGGGGATGAGG + Intergenic
912212018 1:107566988-107567010 GTTCTATGAAGTAGGTGTTGTGG + Intergenic
913585731 1:120273611-120273633 GTGGTAGGAAGAAGTAGAGGAGG + Intergenic
913622454 1:120624758-120624780 GTGGTAGGAAGAAGTAGAGGAGG - Intergenic
914567737 1:148885470-148885492 GTGGTAGGAAGAAGTAGAGGAGG + Intronic
914605086 1:149244775-149244797 GTGGTAGGAAGAAGTAGAGGAGG - Intergenic
915100696 1:153497205-153497227 GTGGGAGGAGGAAGGTGAGGAGG - Intergenic
916833894 1:168521800-168521822 GTTGCAGGAGGAAGGTGATGTGG + Intergenic
916907071 1:169297446-169297468 GAGGGAGGAAGAGGGTGATGAGG - Intronic
917674556 1:177306329-177306351 TTGGGATAAGGAAGGTGATGGGG + Intergenic
918492510 1:185097019-185097041 GTGGTAGGAAGAATGTGGTCTGG + Intronic
918521517 1:185420216-185420238 GTGGTCTGAAGCAGGAGATACGG + Intergenic
919171018 1:193954061-193954083 GAGGTAAGAAGATAGTGATGAGG + Intergenic
921242929 1:213205368-213205390 GTGATGTGAAGAAAGTGATAAGG + Intronic
921369401 1:214406078-214406100 GTGGGATGCTGAAGATGATGTGG - Intronic
923284125 1:232475213-232475235 ATGGTAAGGAGCAGGTGATGAGG - Intronic
1071792775 10:88973326-88973348 GTGGAATGGAGAAGGTGATTAGG + Intronic
1073613851 10:104972601-104972623 GTGGCATGGAGAATGGGATGGGG + Intronic
1076075525 10:127530933-127530955 GTGATAGAAAGAAGGTCATGAGG - Intergenic
1077498153 11:2896662-2896684 GTGGTATGAGAAAGGGGACGTGG + Intronic
1077761007 11:5097858-5097880 GAGGCATGAATAAGGTGATCAGG + Intergenic
1079175112 11:18132950-18132972 TTGGAATGAAGGAGGTGATATGG - Intronic
1079350281 11:19686204-19686226 GTGGTATGAAGCAAGTGACATGG - Intronic
1080600345 11:33816411-33816433 GTGGAATGATGAGGGTGATGGGG + Intergenic
1080901753 11:36500259-36500281 GTGGTATAAATACGGTGGTGAGG + Intronic
1083784305 11:64934982-64935004 GTGGCCTGAAGAAGGTGAGGAGG - Exonic
1085062930 11:73464658-73464680 GTGTTTTGAAGAAAGTGTTGGGG - Intronic
1086550409 11:88046680-88046702 GTGTTTTGTAGAAGGTGTTGGGG - Intergenic
1088574789 11:111260162-111260184 TTGGTATGAAAAAGGGGAGGTGG - Intronic
1090387922 11:126367245-126367267 GTGGCATGCAGAAGGGGAGGGGG - Intronic
1090390561 11:126384691-126384713 GTGGCATGCAGAAGGGGAGGGGG - Intronic
1090550842 11:127818193-127818215 GAGATATGAAGAAGCTGATAGGG - Intergenic
1090581754 11:128168115-128168137 GTGTTATGAAGAAGATGAAACGG + Intergenic
1094740139 12:33279632-33279654 CTGGTATGAGGAAGGGGTTGTGG + Intergenic
1095467531 12:42503767-42503789 AAGGTATAAAGAAGGTGAGGAGG - Intronic
1099450997 12:82806064-82806086 GGGATATGAACAAGGTGCTGTGG + Intronic
1099817564 12:87668628-87668650 GTGGTATCAAGAAGCTGATTTGG + Intergenic
1099984425 12:89646551-89646573 GAGGTTTTAAAAAGGTGATGTGG + Intronic
1102827416 12:115961160-115961182 GTGGTCTGAAGAAAAGGATGTGG + Exonic
1104524286 12:129503869-129503891 GTGATAAGAAGAAGATGAGGAGG - Intronic
1106224949 13:27778233-27778255 GTGGGAAAAAGAAGGTGGTGGGG + Intergenic
1107364693 13:39657330-39657352 ATGGTAAAAAGAAGGTTATGTGG - Intronic
1107745097 13:43496316-43496338 ATGGTCTGAAGAAGGTGTTAAGG + Intronic
1108246682 13:48522554-48522576 CTGGTAGAAAGTAGGTGATGTGG - Intronic
1109699507 13:66007535-66007557 GTGGTATGAAGTTGGACATGAGG - Intergenic
1110114552 13:71795868-71795890 GTGGTATGCAGTAGGTGCTTAGG + Intronic
1111121667 13:83859630-83859652 GGAGTATAAAGAAGGTGATTAGG - Intergenic
1112624899 13:101092789-101092811 GTTCTAGGAAGAAGGTGATCAGG - Intronic
1113628853 13:111866485-111866507 TTGGTAAGAAAAAGGTGATGAGG + Intergenic
1113844123 13:113376137-113376159 GGGGTCTGATGAGGGTGATGGGG + Intergenic
1114186355 14:20405423-20405445 GAGGTGTGAAGGAGGGGATGGGG - Intronic
1114256917 14:21011060-21011082 GTGGTAAGGAAAAGGTAATGAGG - Intergenic
1115583048 14:34781356-34781378 TTGGTATGATGAAGGTGTTCTGG - Intronic
1117490321 14:56240596-56240618 GTGGTAAGTGGAAGGAGATGAGG + Intronic
1118456491 14:65949505-65949527 GGGGTATGATGAAGGAGATATGG - Intergenic
1121339251 14:93095171-93095193 GTGGTATGTAGGTGGTGCTGTGG - Intronic
1121705261 14:95988461-95988483 GGGGTATGGAGAAGGTGGTGGGG - Intergenic
1122734959 14:103833255-103833277 GAGGTAAGAGGAAGGGGATGAGG - Intronic
1122791396 14:104185560-104185582 GTGGTATGAATAGAGAGATGGGG + Intergenic
1122921210 14:104881028-104881050 GTGGTGAGAGGCAGGTGATGGGG + Intronic
1123479029 15:20614101-20614123 GAGGAATGGAGAAGCTGATGGGG + Intergenic
1123638983 15:22386284-22386306 GAGGAATGGAGAAGCTGATGGGG - Intergenic
1123715895 15:23030996-23031018 TTGGTCTGAAGAAAGTGAAGAGG - Exonic
1123998108 15:25733156-25733178 GTGGTGTGAAGGAGGTTACGGGG + Intronic
1124495091 15:30181453-30181475 GTGGGATGAAGATGGGGAGGGGG - Intergenic
1124529778 15:30495543-30495565 GTGGTAAGAGGAAGGTGAATTGG + Intergenic
1124733320 15:32219116-32219138 GTAGAATGAAGCAGGAGATGGGG - Intergenic
1124748478 15:32357192-32357214 GTGGGATGAAGATGGGGAGGGGG + Intergenic
1124768881 15:32512145-32512167 GTGGTAAGAGGAAGGTGAATTGG - Intergenic
1126883161 15:53120959-53120981 CTGGTGTAAAGAAGGGGATGTGG - Intergenic
1128435781 15:67646107-67646129 GTGGTAAGAAGAAGGAGGTGGGG + Intronic
1131338266 15:91571291-91571313 GTGGGATGCAGAAGAAGATGGGG + Intergenic
1133419184 16:5631165-5631187 TTGCTCTGATGAAGGTGATGAGG + Intergenic
1138331156 16:56216492-56216514 GTGGCCTGAAGCAGGTGCTGGGG - Intronic
1140931154 16:79629481-79629503 CTTGTATGAAAAATGTGATGTGG + Intergenic
1141886764 16:86897576-86897598 GAGGCAAGAAGAAGGCGATGTGG + Intergenic
1143863692 17:9908935-9908957 GGGGTATGGAGAAGGTGGCGGGG + Intergenic
1144376711 17:14650157-14650179 GTGGGATGCAGAAGGAAATGTGG + Intergenic
1144414463 17:15033242-15033264 GTAGTAAGAAGTAGGGGATGTGG - Intergenic
1147874854 17:43613919-43613941 GAGGGAGGAAGAAGATGATGGGG + Intergenic
1147915444 17:43882796-43882818 GTGGTCTGAAGATGAAGATGGGG - Intronic
1151219493 17:72601868-72601890 GTGCTATGAAGAATGTGAATTGG + Intergenic
1152007733 17:77693113-77693135 GTGGTGTGAAGAAAGTCATTTGG + Intergenic
1155994325 18:32313736-32313758 GTGGAATGGTAAAGGTGATGAGG + Intronic
1163002450 19:14376500-14376522 GTGGTCTCAGGCAGGTGATGTGG - Intergenic
1163058432 19:14740319-14740341 GTTGGATGAAAAAGGTAATGAGG + Intronic
1163267009 19:16227624-16227646 GTGGGATGAAGGAGATGGTGCGG - Exonic
1163401940 19:17099357-17099379 GGGGACTGCAGAAGGTGATGGGG + Intronic
1163436141 19:17296353-17296375 GTGGCTTGAAGAATCTGATGAGG - Intronic
1164441530 19:28283601-28283623 GTGGTGGGGAGAAGGTGATCAGG - Intergenic
1165397160 19:35570730-35570752 GTGGGATGGAGAAGGGGTTGGGG + Intergenic
1165844730 19:38810846-38810868 GTGCTATGAAGAAAATGAGGAGG - Intronic
1167340580 19:48913539-48913561 GCAGTATGAAGAAGGTCTTGGGG - Exonic
1167485896 19:49762863-49762885 GAGGGAGGAAGAAGGTAATGGGG - Intronic
926120095 2:10237132-10237154 GTGGCAGGGAGGAGGTGATGGGG + Intergenic
926231900 2:11010646-11010668 GTAGAATGAAGAAGGAGACGAGG + Intergenic
928553936 2:32403115-32403137 GTGGTAGGAGGAAGCTGAAGAGG + Intronic
929437959 2:41942708-41942730 GTGGTATGGTGAATGTGATAAGG - Intronic
929888941 2:45903814-45903836 GGGATATGATGAAAGTGATGAGG - Intronic
930826027 2:55697845-55697867 GTAGTAAGAAAAAGTTGATGAGG - Intergenic
931928994 2:67107741-67107763 GTGGCATGAAGAAGGACATGTGG + Intergenic
934898095 2:98135947-98135969 GTGGCCTGAGGAAAGTGATGTGG - Intronic
935678541 2:105617041-105617063 GTGGTCTAAGGAAGGGGATGAGG - Intergenic
936156970 2:110053506-110053528 AAGGTATGGATAAGGTGATGGGG - Intergenic
936187724 2:110317938-110317960 AAGGTATGGATAAGGTGATGGGG + Intergenic
936736486 2:115448841-115448863 GTGCTATGAAGAAAGTGATAGGG - Intronic
937716983 2:125043513-125043535 GTATTATGAAGAAAGTGATAAGG + Intergenic
938068631 2:128294967-128294989 GTGGTTTGGAGTAGGTCATGGGG - Intronic
938594565 2:132774809-132774831 GTGCTATGAAGCAGGTGCTATGG + Intronic
939632104 2:144537582-144537604 GTGGCAGGAAGAGGGGGATGAGG - Intergenic
940646660 2:156399215-156399237 GTGGAATGCAGAGGGTGATTTGG + Intergenic
944621176 2:201517322-201517344 GTGGTATGAGGCAGGGGTTGGGG - Intronic
947622480 2:231599551-231599573 CTGGTATGGACAAGGTGAGGGGG - Intergenic
947863733 2:233381178-233381200 GTGTCATGAAGACGCTGATGTGG + Intronic
948323775 2:237094326-237094348 GTGATATGAAACAGGTGTTGTGG + Intronic
949007523 2:241658210-241658232 GTGGGAGGAGGAAGGTGGTGTGG + Intronic
1168939258 20:1695039-1695061 GGAGTTTGGAGAAGGTGATGGGG - Intergenic
1169025080 20:2363719-2363741 GTGGTAAGAAGAAGATGAACTGG + Intergenic
1170075611 20:12415551-12415573 GTGATATGAAGGAGATGGTGGGG - Intergenic
1170087347 20:12548975-12548997 GTGGTAAGAGGATGGTGTTGTGG - Intergenic
1170109541 20:12790099-12790121 GGGGAAGCAAGAAGGTGATGAGG - Intergenic
1170664856 20:18378045-18378067 AGGGGATGAAGAAGGAGATGGGG + Intergenic
1171174039 20:23037878-23037900 GTGGTATGGGGAAGATGGTGTGG + Intergenic
1172212735 20:33212423-33212445 GTGGGATGAAGCAGTTGGTGGGG + Intergenic
1172480955 20:35271120-35271142 CTGGGAGGCAGAAGGTGATGAGG + Intronic
1173560262 20:44000065-44000087 GTGGTATGAACAAGGGGAATAGG + Intronic
1174767728 20:53269568-53269590 ATGATATGATGATGGTGATGAGG + Intronic
1175491589 20:59384052-59384074 GTGGGGGGAAGGAGGTGATGGGG + Intergenic
1175746136 20:61458707-61458729 GGGTGATGAAGACGGTGATGTGG + Intronic
1175747017 20:61464174-61464196 GTGTTGAGAAGAAGGTGCTGGGG + Intronic
1176381738 21:6117226-6117248 GAGACATGAAGAAGGGGATGCGG - Exonic
1176927301 21:14765801-14765823 GTGGTATGAATAAGATGTTATGG - Intergenic
1176990532 21:15490989-15491011 GTGGGATGAATACGGGGATGGGG + Intergenic
1178091286 21:29166146-29166168 GTGGTAGGAAGAGGGGTATGGGG - Intronic
1178478462 21:32957933-32957955 ATGGCAGGAAAAAGGTGATGGGG + Intergenic
1178798518 21:35768421-35768443 TTGGTATGAAGAAATGGATGAGG - Intronic
1179297779 21:40078864-40078886 CTAGTGTGAAGGAGGTGATGGGG + Exonic
1179741734 21:43421013-43421035 GAGACATGAAGAAGGGGATGCGG + Exonic
1180072783 21:45444929-45444951 GTGGTTTGGAAAATGTGATGTGG + Intronic
1181743500 22:24939813-24939835 GTGCCATGAAGAAGGTGGAGGGG - Intronic
1182083501 22:27545434-27545456 CTGTTATGAAGGAGCTGATGTGG - Intergenic
1183127883 22:35802711-35802733 GTGGTCTGAAGAGGGTGCAGTGG + Intronic
1184277718 22:43419682-43419704 GTGGTGTGACCATGGTGATGGGG + Intronic
1184942829 22:47781510-47781532 GTGGGGTGAAGAACGCGATGAGG + Intergenic
949287083 3:2419680-2419702 GTGTCATGCAGAAGATGATGAGG + Intronic
949573261 3:5313633-5313655 GAAGAATGAACAAGGTGATGAGG + Intergenic
949875780 3:8625203-8625225 GTGGAAGGAAGGAGGGGATGAGG + Intronic
951597702 3:24335924-24335946 GTGGGATGAAGAAGAGGCTGGGG + Intronic
951802233 3:26608571-26608593 GTGGTAAGAAGCAGCTGATTTGG + Intergenic
952485866 3:33809004-33809026 AAGGCATGAAAAAGGTGATGAGG - Intronic
956755693 3:72383758-72383780 GTGAGATGAAAAGGGTGATGAGG + Intronic
958688219 3:97426511-97426533 ATGGTATAAAGAAGGTGACATGG - Intronic
958983567 3:100753905-100753927 GTGGCATGGTGAAGATGATGGGG + Intronic
960459279 3:117913706-117913728 GTGCTATGAGGAAGGGGAAGAGG - Intergenic
961222219 3:125210342-125210364 GTGGCAGGAAGAAGAAGATGTGG + Intronic
962920946 3:139949999-139950021 GTGGGATGCTGAATGTGATGAGG + Intronic
963605046 3:147406213-147406235 GTAGGATGAAGGAGGAGATGGGG + Intronic
965820666 3:172681133-172681155 GGGGCAGGAAGAAGGGGATGAGG + Intronic
966680949 3:182641811-182641833 GTGAAATGAAGATGGAGATGAGG + Intergenic
966778304 3:183562092-183562114 GTGGGATGAAAAATGGGATGTGG - Intergenic
966937155 3:184718288-184718310 GTGGTATCAATAAAGTGTTGTGG + Intergenic
967451412 3:189627754-189627776 GTGGTATGAGGAAAGTTTTGGGG + Intergenic
968063716 3:195746543-195746565 GGGGGAAGAAGAAGGTGATGTGG + Intergenic
968713048 4:2134597-2134619 GTGGTATCAAAAAGGTGGGGAGG - Intronic
971857088 4:32058019-32058041 GGGCAATGTAGAAGGTGATGTGG - Intergenic
972276937 4:37566185-37566207 AGGTTATGAAGTAGGTGATGTGG - Intronic
972346465 4:38196556-38196578 GTGGTATTAAGTAGGTGGTCAGG + Intergenic
974910081 4:68107394-68107416 GTGGTAGGATTAAGGTGATCAGG + Intronic
976695137 4:87910904-87910926 GTGCTACAAAGAGGGTGATGTGG - Intergenic
978047488 4:104149472-104149494 GTAGTAAGAAGAAGGTGAGCTGG - Intergenic
981533058 4:145771600-145771622 GTGGGAGAAAGAAGGTGAGGAGG + Intronic
982029003 4:151280182-151280204 CTGGTATTTAGAAGGTGATTTGG - Intronic
983268340 4:165531729-165531751 GTGATATGAAGAAAATAATGCGG + Intergenic
983619018 4:169740161-169740183 CAGGTATGAAAAAGGTGAAGTGG + Intronic
985572160 5:652830-652852 GTGGGACACAGAAGGTGATGGGG + Intronic
987685567 5:21195752-21195774 CTGGTATGGAGACGGTTATGTGG - Intergenic
988443240 5:31256323-31256345 AAGGTCTGAAGAAAGTGATGGGG - Intronic
988702494 5:33689333-33689355 GTGGCATGGAGATGGGGATGGGG + Intronic
989023279 5:37035876-37035898 GTGTTATGAATAATGAGATGAGG - Intronic
989415441 5:41169683-41169705 GTGGTAGGAGGAGGGTGAAGGGG + Intronic
990771824 5:59255421-59255443 GTGATATGGAGCAGGTAATGGGG + Intronic
993243756 5:85425276-85425298 GGGGGAGGAAGAGGGTGATGTGG - Intergenic
995026112 5:107424688-107424710 GTGGAATGAACAAGATGATTGGG - Intronic
995239838 5:109873348-109873370 TTGTTAGGAAGAAGGTGAAGGGG - Intergenic
995647599 5:114330088-114330110 GTAGTATGAAGCAGCTGATTGGG - Intergenic
996309397 5:122086763-122086785 ATGGTATGAAGTAGGAGTTGAGG + Intergenic
997924087 5:138012027-138012049 GTTGTATTAAAAAGGTGATGTGG - Intronic
999501296 5:152149115-152149137 GTGGTGGGAAGAAGGGGAAGAGG - Intergenic
999662045 5:153874606-153874628 GAGGCCTGAAGAAGGTGATTAGG - Intergenic
1001068459 5:168560338-168560360 GAGGTTTGAAGGAGGTGAGGGGG - Intronic
1001173299 5:169442141-169442163 GTGGTGTGAGGAAGGTGAGAAGG - Intergenic
1001298577 5:170516974-170516996 GTGGTGTGATGGTGGTGATGGGG + Intronic
1002358407 5:178649806-178649828 GTGGTATGTTGAGGGTGATTGGG + Intergenic
1003515188 6:6811856-6811878 GAGAAATGACGAAGGTGATGAGG - Intergenic
1004403844 6:15313318-15313340 GTTGTATGAAGAAAGCGCTGTGG + Intronic
1005110890 6:22280405-22280427 TTGGTAAGAAGAAGGTGAGCTGG - Intergenic
1005506883 6:26477126-26477148 GTGGTGTGAAGAAGAAGAAGAGG - Intergenic
1006530251 6:34646013-34646035 CTGGTATGAAGACTGTAATGAGG + Intronic
1006602213 6:35233540-35233562 CTGGGATGAAGAGGGTGGTGAGG - Intronic
1006662983 6:35664684-35664706 CTGGTATGAAGTGGTTGATGGGG - Intronic
1008428111 6:51382486-51382508 GTGATTTGAAGTAGATGATGGGG + Intergenic
1009545488 6:65014537-65014559 GTGGGATACAGAAGGGGATGGGG + Intronic
1010586498 6:77662770-77662792 TTGTTTTGTAGAAGGTGATGGGG + Intergenic
1011344539 6:86354350-86354372 ATGGTAGCAGGAAGGTGATGTGG + Intergenic
1012587079 6:100936547-100936569 GTGGAAGGAGGAAGGAGATGTGG + Intergenic
1015365267 6:132390272-132390294 GTACTATGAAGAAGATGATCTGG - Intronic
1015958417 6:138622149-138622171 GGGGAAAGAAGAAGGTGAGGAGG + Intronic
1016437825 6:144056065-144056087 GTGGGATGGAGAAAGGGATGAGG - Intronic
1018533483 6:164793779-164793801 GTGGTCTGAAGAAGTTTATGGGG + Intergenic
1018996679 6:168715526-168715548 TGGGGATGAAGATGGTGATGAGG + Intergenic
1021557922 7:21940539-21940561 GTGGTATGATAAATGTGATCAGG + Intronic
1021624506 7:22579534-22579556 GGGAAATAAAGAAGGTGATGAGG + Intronic
1022662173 7:32377324-32377346 GTGGTATGAACAAAGTGCTTTGG - Intergenic
1022685616 7:32593609-32593631 ATGATATAAAGAAAGTGATGGGG + Intergenic
1023784801 7:43695303-43695325 GAGGTAAAAAGAAGGAGATGAGG - Intronic
1024946404 7:54812025-54812047 GTGGTATGATGAAGGTCACTTGG - Intergenic
1031432095 7:121684349-121684371 GTGGGAATAAGAAGGTGATATGG - Intergenic
1032075768 7:128835414-128835436 GTGGGAGGATGAAGATGATGAGG + Exonic
1032432870 7:131876801-131876823 GTGGTATGCACATGTTGATGTGG - Intergenic
1034497910 7:151433115-151433137 GTGGTGTGCAGAAGGGGAGGAGG - Intronic
1034513688 7:151556883-151556905 CTGGTATGGAACAGGTGATGTGG - Exonic
1035214184 7:157352482-157352504 GTGGTATGAAGATGGGGGTGGGG + Intronic
1035862517 8:3045581-3045603 GAAGTATTAAGTAGGTGATGGGG - Intronic
1036974301 8:13393739-13393761 GTGGTAGGAAGAAGGGCATTTGG - Intronic
1037309299 8:17537562-17537584 GGGGTATGAAGACAGTGCTGTGG + Intronic
1037831481 8:22192207-22192229 GGGGGATGAAGAGTGTGATGAGG - Intronic
1038517059 8:28196285-28196307 GTGGCTTGGAGCAGGTGATGGGG - Intergenic
1038570116 8:28654752-28654774 GGGGTATGAAAAAGAAGATGGGG - Intronic
1039354062 8:36795533-36795555 GTGGTTGGTGGAAGGTGATGTGG + Intronic
1039473847 8:37829140-37829162 GTGGGATGAAAAAGGAGATGAGG - Intronic
1042749390 8:72141430-72141452 GGGGTAGTAAAAAGGTGATGAGG - Intergenic
1042808608 8:72799123-72799145 GAGGTGAGAAGATGGTGATGGGG - Intronic
1044478500 8:92656582-92656604 GTGTGATGGGGAAGGTGATGAGG + Intergenic
1044888488 8:96806099-96806121 GTGGGATGGAGAAGGGGATGAGG + Intronic
1045744915 8:105406974-105406996 GTGGAATGAGGAAGGTGGTGTGG + Intronic
1047232196 8:123007165-123007187 GTAGAAAGGAGAAGGTGATGTGG - Intergenic
1048745136 8:137606124-137606146 ATGGTGTTAATAAGGTGATGAGG + Intergenic
1051236835 9:15009619-15009641 TTGGTATGGAAAAGGTGAAGTGG - Intergenic
1053157780 9:35792258-35792280 CTGGGATGCAGAAGGTGCTGGGG - Exonic
1053344922 9:37371184-37371206 GTGCTATGAAGAAACTGGTGTGG + Intergenic
1055043594 9:71901698-71901720 GAGGAATGAAGAGGGGGATGGGG - Intronic
1059656452 9:116361986-116362008 ATGGCATGAAGAGGGTGATATGG - Intronic
1059831774 9:118104196-118104218 GTGGTACAAAGATGGTGCTGAGG - Intergenic
1060039290 9:120285926-120285948 GTTGTATGAATAAGGGGGTGAGG - Intergenic
1060175730 9:121496350-121496372 GTGATATGGAGATGGTGATATGG - Intergenic
1185724927 X:2411961-2411983 GAGGAATGGAGAAGGTGAGGTGG + Intronic
1185819536 X:3188748-3188770 TTGGGATAAAGAAGGTGATGTGG - Intergenic
1186242361 X:7583240-7583262 GGGGTATTTAGAAGGTGATTAGG - Intergenic
1187076805 X:15943626-15943648 GTAGTATCAAGAGGGTGAGGTGG + Intergenic
1187358830 X:18604915-18604937 GTGGTACGAGGGATGTGATGAGG + Intronic
1188638569 X:32467447-32467469 GTTTCAGGAAGAAGGTGATGTGG + Intronic
1189081298 X:37975455-37975477 ATGGTTTGAAGAGAGTGATGAGG + Intronic
1191849435 X:65575088-65575110 GAGGGAGGAAGAAGGTGAGGGGG + Intergenic
1194982829 X:100457951-100457973 ATGGTGTAAAGAAGGTGATACGG - Intergenic
1196237754 X:113302564-113302586 GTTTTATGAATAAGTTGATGTGG - Intergenic
1198831944 X:140760128-140760150 GAGGTAAGAACAAAGTGATGTGG + Intergenic
1199543391 X:148982429-148982451 CAGGTATGAACAAGGTGCTGTGG + Intronic
1200647903 Y:5808742-5808764 GTGGTAGGAAGAACTTGATATGG + Intergenic
1201260510 Y:12154461-12154483 ATGGGATAAAGAAGGTGATGTGG + Intergenic