ID: 906064248

View in Genome Browser
Species Human (GRCh38)
Location 1:42968784-42968806
Sequence CATTTGGGGCTGAGGCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906064237_906064248 -7 Left 906064237 1:42968768-42968790 CCAGTGCCCAACCCAACATTTGG No data
Right 906064248 1:42968784-42968806 CATTTGGGGCTGAGGCTGGGAGG No data
906064236_906064248 -2 Left 906064236 1:42968763-42968785 CCTGGCCAGTGCCCAACCCAACA No data
Right 906064248 1:42968784-42968806 CATTTGGGGCTGAGGCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906064248 Original CRISPR CATTTGGGGCTGAGGCTGGG AGG Intergenic
No off target data available for this crispr