ID: 906065029

View in Genome Browser
Species Human (GRCh38)
Location 1:42974669-42974691
Sequence CTGATTCTACAGAAGGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 272}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906065026_906065029 -8 Left 906065026 1:42974654-42974676 CCTGATTTCACAGCTCTGATTCT 0: 1
1: 1
2: 2
3: 21
4: 261
Right 906065029 1:42974669-42974691 CTGATTCTACAGAAGGAGGCCGG 0: 1
1: 0
2: 2
3: 17
4: 272
906065025_906065029 16 Left 906065025 1:42974630-42974652 CCACTGGAGTTCTCTGAAAAGGT 0: 1
1: 0
2: 2
3: 18
4: 177
Right 906065029 1:42974669-42974691 CTGATTCTACAGAAGGAGGCCGG 0: 1
1: 0
2: 2
3: 17
4: 272
906065023_906065029 17 Left 906065023 1:42974629-42974651 CCCACTGGAGTTCTCTGAAAAGG 0: 1
1: 0
2: 0
3: 10
4: 188
Right 906065029 1:42974669-42974691 CTGATTCTACAGAAGGAGGCCGG 0: 1
1: 0
2: 2
3: 17
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906065029 Original CRISPR CTGATTCTACAGAAGGAGGC CGG Intergenic
900595865 1:3479892-3479914 CTGGTTCTGCAGCAGGAGGATGG + Exonic
900826333 1:4930139-4930161 CTTATTCTAAAGCAGCAGGCAGG - Intergenic
901206498 1:7500595-7500617 CTGCTGCTACAGAAGCGGGCAGG - Intronic
901315392 1:8304034-8304056 CTGAGTGGACAGAGGGAGGCAGG + Intergenic
905996411 1:42385094-42385116 CTGGTTCTTCAGAGGGAGGGGGG - Intronic
906065029 1:42974669-42974691 CTGATTCTACAGAAGGAGGCCGG + Intergenic
906520832 1:46466159-46466181 TTGACTCTAGTGAAGGAGGCAGG - Intergenic
906674391 1:47682723-47682745 CTGAGTCTAAAGAATGAGCCAGG - Intergenic
908859143 1:68463724-68463746 CTGATTTAACAGAGGGAGGAGGG - Intergenic
910322109 1:85957895-85957917 ATGATACTAGTGAAGGAGGCAGG - Intronic
910379792 1:86614040-86614062 TAGAGTCTACAGAAGCAGGCAGG + Intergenic
911431942 1:97800797-97800819 TTGACTCTACAGAAGGTGGAAGG - Intronic
912184162 1:107254500-107254522 TGGATTCTTCAGAAGGAGCCCGG - Intronic
912190004 1:107327044-107327066 CTGAGTCCAGAGAAGGAGGGAGG - Intronic
912474806 1:109928615-109928637 CTGATTCCCCAGGAGGAGGTAGG + Intronic
913151893 1:116052434-116052456 TGGAGCCTACAGAAGGAGGCAGG - Intronic
915869087 1:159538741-159538763 CAGAGTCTACAGAGGCAGGCAGG - Intergenic
916460766 1:165022017-165022039 TGGAGTCTACAGAAGCAGGCAGG + Intergenic
917207886 1:172596887-172596909 CGGAGTCTACAGAGGCAGGCAGG + Intronic
918200249 1:182259625-182259647 ATGAGTCTGCAGAAGCAGGCTGG + Intergenic
920195405 1:204223199-204223221 TTGCTTCTCCAGAAGCAGGCAGG - Intronic
924573589 1:245259465-245259487 ATGATTCTAGAGAATAAGGCCGG + Intronic
1062835791 10:635027-635049 CTGATTCCACAGGAGGAGTTTGG - Intronic
1063631902 10:7741867-7741889 CTGAGTGTACAGAATGAGGAAGG - Intronic
1065441858 10:25761316-25761338 CTGAAATTACAGATGGAGGCTGG + Intergenic
1065563871 10:26989769-26989791 CTCATTCAACAGAAGGCAGCAGG - Intergenic
1067940439 10:50650655-50650677 CTGGTTCTACAGGGGGAGTCTGG - Intergenic
1068552587 10:58423330-58423352 TGGAGTCTACAGAAGCAGGCAGG + Intergenic
1068576218 10:58687469-58687491 TGGAGTCTACAGAGGGAGGCAGG + Intronic
1069624665 10:69860441-69860463 CTCATTCTTCAGCAGAAGGCAGG - Intronic
1069625558 10:69865736-69865758 TTGAGTCTAGAGAAGGGGGCTGG + Intronic
1069690918 10:70351433-70351455 CTCATTCTATGGAAGGAGGAGGG - Intronic
1070437984 10:76412295-76412317 CTGCTTCTACATAGGGAGGGAGG + Intronic
1071405777 10:85329828-85329850 CTGTTTCTTCAGATGGAGCCTGG - Intergenic
1071696024 10:87872513-87872535 CTGAGTCTGAAGAAGGATGCAGG + Intronic
1072397910 10:95064228-95064250 TGGATTCTACAGAGGCAGGCAGG + Intronic
1073420686 10:103421499-103421521 CTGATTCAGGAGGAGGAGGCTGG - Exonic
1073870304 10:107855501-107855523 CTAATGCTACAAAGGGAGGCAGG + Intergenic
1075977021 10:126704950-126704972 CCGAGTCTAGACAAGGAGGCAGG + Intergenic
1076794423 10:132791697-132791719 CTTTTTCTACTGCAGGAGGCTGG + Intergenic
1077717719 11:4598646-4598668 CTGATTCTCAAGAAGCAGTCTGG + Intergenic
1078359173 11:10655093-10655115 CTGATTCTACTAAAGGAAGTTGG + Intronic
1081768270 11:45628092-45628114 TGGAGTCTACAGAGGGAGGCAGG - Intergenic
1082107484 11:48236263-48236285 TGGAGTCTACAGAAGCAGGCCGG + Intergenic
1082144412 11:48649445-48649467 TGGAGTCTACAGAAGCAGGCAGG + Intergenic
1083516631 11:63265049-63265071 ATGAATCTAGAGAGGGAGGCAGG - Intronic
1083770107 11:64862391-64862413 TTCATTCTGCTGAAGGAGGCTGG - Intronic
1084432051 11:69116564-69116586 CTGAGCCTTCAGGAGGAGGCTGG + Intergenic
1087103203 11:94384741-94384763 TGGAGTCTACAGAGGGAGGCAGG - Intronic
1087388681 11:97506719-97506741 TTTATTCTACAAAAGGAGCCTGG + Intergenic
1088302507 11:108374062-108374084 CTGAGCCTACAGAGGCAGGCAGG - Intronic
1090155219 11:124430293-124430315 GTGCTTTCACAGAAGGAGGCTGG - Intergenic
1092188772 12:6502087-6502109 CTGATGCTGCAGAAGGAAGAGGG + Intronic
1092385954 12:8035705-8035727 CTGATTCCAGAGAAGCAAGCAGG - Intronic
1092651688 12:10641784-10641806 CTGGCTGTACAGAATGAGGCAGG - Intronic
1093086185 12:14868926-14868948 CTGCTTCTATAAAAGGGGGCAGG - Intronic
1093261002 12:16937910-16937932 CTGGACCTACAGAAAGAGGCAGG - Intergenic
1094755065 12:33458865-33458887 CTGATTCTACAGAAGTAAAAAGG + Intergenic
1094792256 12:33928789-33928811 TGGAGTCTACAGAAGCAGGCAGG - Intergenic
1095508371 12:42922659-42922681 CTGCTTTTACAAAAGGAGTCAGG - Intergenic
1098586097 12:72155994-72156016 TGGATTCTACAGAGGCAGGCAGG + Intronic
1098898876 12:76092411-76092433 CTGATTCTGAGGTAGGAGGCAGG + Intergenic
1099720561 12:86356863-86356885 TGGATTCTACAGAGGCAGGCAGG - Intronic
1102248361 12:111369062-111369084 CGGATCCGACGGAAGGAGGCGGG + Exonic
1104351100 12:128044688-128044710 CTGAATCCATACAAGGAGGCAGG - Intergenic
1104588846 12:130068477-130068499 CTGGTTGTACAGATGCAGGCAGG - Intergenic
1107276935 13:38688529-38688551 CAGAGTCTTCAGAAGGGGGCTGG - Exonic
1108691137 13:52860318-52860340 CTGATGCTACAGATGCAGACGGG + Intergenic
1108929975 13:55806438-55806460 CACATTCTACACAAGAAGGCAGG + Intergenic
1111844905 13:93496003-93496025 TGGATCCTACAGAGGGAGGCAGG + Intronic
1113429730 13:110239698-110239720 CTGAATATGCAGAAGGTGGCAGG + Intronic
1113671652 13:112179617-112179639 CTGATACTGCAGAAGGAAGGGGG + Intergenic
1113829961 13:113287936-113287958 CTGAGTCTGCTGATGGAGGCTGG - Intergenic
1113936158 13:113996203-113996225 CTGCTTCTCTAGGAGGAGGCTGG - Intronic
1114197212 14:20489413-20489435 CTAGTTCTACAGAAGGAGGGTGG + Intergenic
1116711329 14:48371855-48371877 TGGAGTCTACAGAGGGAGGCAGG + Intergenic
1116727214 14:48575858-48575880 CGGAGTCTACAGAGGCAGGCAGG + Intergenic
1118002907 14:61540210-61540232 CTGATTCTATGGAAGGAGAAGGG - Intronic
1118062826 14:62159653-62159675 CTGAATCTACAGTGGGAGTCTGG + Intergenic
1118213875 14:63790001-63790023 CTCATTCTACAGAGGGAGGGTGG - Intergenic
1118701110 14:68434343-68434365 TGGAGTCTACAGAAGCAGGCAGG + Intronic
1119007077 14:70941730-70941752 TGGATTCTACAGAGGCAGGCAGG + Intronic
1120845045 14:89117996-89118018 CTGAGTCTGCAGCAGGAGCCTGG + Intergenic
1121573360 14:94964106-94964128 TTGACCCTACAGAATGAGGCTGG + Intergenic
1121846180 14:97174001-97174023 ATGATTCTACAGAGAAAGGCTGG + Intergenic
1122438635 14:101715533-101715555 GTGATACTACAGAGGGAGGCAGG + Intergenic
1127041835 15:54985323-54985345 ATGATGTTCCAGAAGGAGGCAGG - Intergenic
1128723894 15:69973775-69973797 CTGATTTCACAGATGGGGGCAGG - Intergenic
1129718727 15:77866308-77866330 CTGAGGCTCCACAAGGAGGCTGG - Intergenic
1130141257 15:81228186-81228208 CCTATTCCACAGCAGGAGGCTGG + Intronic
1130813496 15:87406369-87406391 TTCATTCTACAGAAGGAAGCAGG - Intergenic
1130893726 15:88154295-88154317 CTGCTTCAACCCAAGGAGGCTGG - Intronic
1132366913 15:101264475-101264497 CTGTTTCTGCAGGAGGAAGCAGG - Intergenic
1132858496 16:2058140-2058162 CTGGTTCTACGGGAGGAGGGAGG - Intronic
1134043931 16:11087840-11087862 CTGCTTCCACACAAGGTGGCTGG + Intronic
1134559620 16:15197055-15197077 CTGATTCTACTCAGGGAGTCAGG + Intergenic
1134920160 16:18108666-18108688 CTGATTCTACTCAGGGAGTCAGG + Intergenic
1138437642 16:57013893-57013915 CAGATTCTACAAAATGCGGCTGG + Intronic
1140555539 16:75916841-75916863 CAGATTCTACAGATGCAGGGTGG + Intergenic
1140996675 16:80266616-80266638 CTGATGCAACAGAAGGAAGAGGG + Intergenic
1141079012 16:81034760-81034782 CTGATTCTGGAGATGGAGGAAGG + Intergenic
1141506171 16:84480099-84480121 CTGATTCCACCCAAGAAGGCTGG - Intronic
1142978900 17:3660327-3660349 CTGTTTGTACAGAAAGAGACCGG + Exonic
1146372082 17:32271107-32271129 CTGAATCAACAGAAGGAATCAGG - Intronic
1148460616 17:47837317-47837339 CTGATTCTAAAGAGCGAGTCTGG + Exonic
1149154878 17:53616159-53616181 CTGATTCTACAGAAGTAGGATGG + Intergenic
1149573444 17:57694302-57694324 CTTATTCTTAAGATGGAGGCTGG + Intergenic
1149802260 17:59580783-59580805 CTGTTTCAAAAGAAGGGGGCTGG + Intronic
1149844231 17:59994706-59994728 CTGTTTCAAAAGAAGGGGGCTGG - Intergenic
1153090369 18:1335717-1335739 TGGAATCTACAGAAGCAGGCAGG - Intergenic
1155248317 18:23932479-23932501 CTGCTCCTCCAAAAGGAGGCCGG - Intronic
1157422475 18:47558441-47558463 AGGATGCTAGAGAAGGAGGCAGG + Intergenic
1158660576 18:59383974-59383996 CAGATGCTTCAGCAGGAGGCTGG - Intergenic
1160031940 18:75269556-75269578 CTGACTCCACAGAGGGAGCCTGG + Intronic
1160062093 18:75540103-75540125 TTGAATCTGCAGAAGGAGGAAGG + Intergenic
1160975844 19:1792019-1792041 CCGGTTCTGCAGCAGGAGGCTGG + Exonic
1161097327 19:2400202-2400224 TTGATTCTACAGTAGGGGGTTGG - Intronic
1167320817 19:48796324-48796346 CTGGTACTACTGAAGGAGGCTGG + Intronic
1167717151 19:51150823-51150845 GTGATTAGACAGAGGGAGGCAGG + Intronic
925355101 2:3235313-3235335 CTTATTCTTCAGATGAAGGCCGG - Intronic
925434950 2:3828718-3828740 CTGATTCTACAGAATTTGGTAGG - Intronic
927447031 2:23172065-23172087 TGGAGTCTACAGAAGCAGGCAGG - Intergenic
927827189 2:26317050-26317072 CTGATTCTACAGGAGCAGAGGGG + Exonic
928171350 2:29006525-29006547 GTGACTCTACTGAAGGAGCCAGG - Intronic
930359909 2:50364401-50364423 GTGATTTTTCTGAAGGAGGCAGG - Intronic
930467634 2:51774674-51774696 TGGAGTCTACAGAAGCAGGCAGG + Intergenic
931530693 2:63210997-63211019 CAGAGTCTACAGAGGCAGGCAGG - Intronic
931968609 2:67561285-67561307 CTGACCTTGCAGAAGGAGGCAGG + Intergenic
935450265 2:103201079-103201101 TGGAATCTACAGAAGCAGGCAGG - Intergenic
935628890 2:105195660-105195682 AGGATTTTAGAGAAGGAGGCTGG + Intergenic
939533105 2:143390329-143390351 CTGATCCTAGAAAAGGGGGCAGG + Intronic
939925633 2:148170815-148170837 CTGATTCTACAGAAACAGAATGG + Intronic
941178341 2:162228023-162228045 TTGATTATACAGAGGGAGGTGGG - Intronic
941892722 2:170598377-170598399 CTGTTTATTCAGATGGAGGCAGG - Intronic
947668998 2:231925165-231925187 CTGCTTCTCCAGAAGAAGCCAGG + Intronic
1168823689 20:794342-794364 CTGGTCCTCCAGATGGAGGCTGG - Intergenic
1170262770 20:14429825-14429847 ATGGTTCTCCTGAAGGAGGCTGG - Intronic
1170399772 20:15968995-15969017 CTGATTCTACAGAAGGTGTCTGG + Intronic
1171140314 20:22735187-22735209 GTGAGTCTACAGAGGCAGGCAGG - Intergenic
1173854025 20:46238177-46238199 CTGATGCTAGAGAAGGAAGCAGG - Intronic
1174465674 20:50715369-50715391 CTGATTTTAAAGATGGAGGTGGG + Intergenic
1175681056 20:60989256-60989278 CTGACTCCACAGGACGAGGCAGG + Intergenic
1176545452 21:8195672-8195694 CTGATTCTGCAAAAGCAGGTGGG + Intergenic
1176564403 21:8378717-8378739 CTGATTCTGCAAAAGCAGGTGGG + Intergenic
1177776143 21:25568485-25568507 CTTATTCCACAGAATGAGTCTGG + Intergenic
1179512702 21:41884471-41884493 CTGATGCTCCAGGAGGAGGCTGG - Intergenic
1180801166 22:18632600-18632622 CCCATTTTACAGTAGGAGGCTGG - Intergenic
1180852395 22:19028159-19028181 CCCATTTTACAGTAGGAGGCTGG - Intergenic
1181220555 22:21362661-21362683 CCCATTTTACAGTAGGAGGCTGG + Intergenic
1182165038 22:28164186-28164208 TGGAGTCTACAGAAGCAGGCAGG - Intronic
1182518592 22:30872674-30872696 CTGATTCAACAGCAGGAGCTTGG - Intronic
1183628064 22:39016781-39016803 CTGATTCCTCAGCAGAAGGCAGG + Intronic
1184878194 22:47288775-47288797 GTGAGTCTAGTGAAGGAGGCTGG + Intergenic
1184912368 22:47544801-47544823 CTGATTGGACAGCAGCAGGCTGG + Intergenic
1203250322 22_KI270733v1_random:111910-111932 CTGATTCTGCAAAAGCAGGTGGG + Intergenic
950047139 3:9955467-9955489 CAGAGTCTGCAGAAGGATGCTGG - Intergenic
950906531 3:16544089-16544111 CTGCTTCCCCAGGAGGAGGCTGG - Intergenic
951802776 3:26614832-26614854 CAAGTTCTACAGAAGGAGGAAGG + Intergenic
952858843 3:37795496-37795518 TAAATTCTACAGAAGCAGGCAGG + Intronic
953634216 3:44648780-44648802 CTGGCTCTGCAGCAGGAGGCTGG - Exonic
954364099 3:50137276-50137298 CAGTTTCCAAAGAAGGAGGCTGG - Intergenic
955135497 3:56213557-56213579 CAGAGTCTACAGAGGCAGGCAGG - Intronic
956075735 3:65503273-65503295 CTGATTCCTGAGGAGGAGGCTGG - Intronic
957535094 3:81492336-81492358 CTGATTCAATAAAAGGAAGCTGG + Intronic
959885808 3:111498054-111498076 CTGATTCTTCAGATGGAAGGTGG - Intronic
962180340 3:133199866-133199888 TGGAGTCTACAGAAGCAGGCAGG + Intronic
964155928 3:153584512-153584534 TGGATTCTACAGAGGCAGGCAGG - Intergenic
964506841 3:157408892-157408914 GTGAAGCTACAGAAGGAAGCTGG + Intronic
967354313 3:188550950-188550972 TTGTTTCTACAGAAGGAGTTTGG + Intronic
970471545 4:16384414-16384436 CTGATTCTGCAGAGGGACTCCGG - Intergenic
970951070 4:21756016-21756038 CTGATTCTAAAAAAGGAGTTGGG - Intronic
971481068 4:27115564-27115586 GTGATTCAACAAAATGAGGCTGG - Intergenic
974276250 4:59724350-59724372 TGGATTCTACAGAGGCAGGCAGG + Intergenic
975235906 4:71996558-71996580 TGGAGTCTACAGAAGCAGGCGGG - Intergenic
977478003 4:97537586-97537608 TGGAGTCTACAGAAGCAGGCAGG - Intronic
977920906 4:102641436-102641458 CTGAGACTACTGAAGGAGGAAGG + Intronic
979042152 4:115812201-115812223 TAGATTCTACAGAGGCAGGCAGG - Intergenic
981060858 4:140423838-140423860 CTGATTCTACAGAAATAAGAGGG - Intronic
983668327 4:170207613-170207635 TGGAGTCTACAGAAGCAGGCAGG - Intergenic
983879092 4:172912756-172912778 TGGAGTCTACAGAAGCAGGCAGG - Intronic
983977515 4:173953261-173953283 GTGATTCCACAGAAGGAGTCAGG + Intergenic
984208065 4:176811353-176811375 CTGATTCTACAGAAGTAAGAAGG - Intergenic
985182280 4:187278375-187278397 CTGATTACAAAGAAGGAGGTAGG - Intergenic
986310304 5:6546304-6546326 CTGATTCTCCGGACCGAGGCGGG - Intergenic
986676802 5:10192993-10193015 CTGGTTCAACAGAAGAAGGGTGG - Intergenic
986861860 5:11936157-11936179 CTTATCCTCCAGAAGGAGGCTGG - Intergenic
989248556 5:39281338-39281360 TGGAGTCTACAGAAGCAGGCAGG + Intergenic
989527341 5:42468483-42468505 CTGGCTCTGCAGCAGGAGGCTGG + Intronic
989956543 5:50367295-50367317 TTGAGTCTACAGAGGCAGGCAGG - Intergenic
990356753 5:54975248-54975270 CTTATTTTAGAGAAGGAGGCAGG - Intergenic
992085316 5:73273138-73273160 CTGAATCCACAGATGGAGGAGGG - Intergenic
993355533 5:86902580-86902602 TTGGTTTTACAGAAGGAGGAGGG - Intergenic
993532707 5:89043873-89043895 CTGATGATAAGGAAGGAGGCAGG - Intergenic
994247424 5:97495568-97495590 CTGATTCCAAAGAAGGAAGAAGG + Intergenic
996639975 5:125740466-125740488 TGGATTCTACAGAGGCAGGCAGG + Intergenic
998404552 5:141866844-141866866 CTGATTTTTCAGAGGCAGGCGGG - Intronic
999382194 5:151129184-151129206 GTAAGGCTACAGAAGGAGGCAGG - Intronic
1000125994 5:158244784-158244806 CTGATTATACACAAGGATGCAGG + Intergenic
1000158638 5:158577471-158577493 GTGAGTCTACAGAGGCAGGCAGG + Intergenic
1001563498 5:172685124-172685146 CTCTTTCTACAGAAGGAAACAGG - Intronic
1001728008 5:173924086-173924108 ATGTTTCTACAGATGGAGGAAGG - Intronic
1001986414 5:176077076-176077098 CTGAATCCACAGCAGGAGGTTGG - Intronic
1002230453 5:177761049-177761071 CTGAATCCACAGCAGGAGGTTGG + Intronic
1002264883 5:178022698-178022720 CTGAATCCACAGCAGGAGGTTGG - Intronic
1002321250 5:178377407-178377429 CTGATTCTCCAGAAGCAGTGGGG - Intronic
1002602778 5:180363457-180363479 GTGATTCCACAGAAGAAGTCAGG - Intergenic
1004109417 6:12700857-12700879 TTGACTCTAGAGAAGGAAGCCGG + Intergenic
1004339794 6:14798327-14798349 CTGACTCTACAGGGGGAGGGAGG - Intergenic
1005042610 6:21612790-21612812 CTGTATCTAAAGGAGGAGGCTGG - Intergenic
1005401581 6:25439564-25439586 CTGACTCTGCAGAATGATGCTGG + Intronic
1005726611 6:28655378-28655400 CTGAGTCTCCTGCAGGAGGCTGG + Intergenic
1005979779 6:30828121-30828143 CTGGGTCAACAGATGGAGGCAGG + Intergenic
1006810611 6:36818081-36818103 CTCATCCTACAGACGGGGGCAGG - Intronic
1008281279 6:49599084-49599106 TGGAGTCTACAGAGGGAGGCAGG - Intergenic
1009457924 6:63878576-63878598 CAGAGTCTACAGAAGCAGGCAGG + Intronic
1009838342 6:69034165-69034187 CAGATTCTTCAAAAGGAGGAAGG - Intronic
1010478559 6:76320530-76320552 ATGATTCTACAAAAGGAAACAGG - Intergenic
1013904152 6:115195492-115195514 CTGCTTCCACAGCAGGAGCCTGG - Intergenic
1014765027 6:125396442-125396464 TGGAGTCTACAGAAGCAGGCAGG - Intergenic
1014842877 6:126240808-126240830 CGGAGTCTACAGAGGCAGGCAGG + Intergenic
1015050111 6:128829992-128830014 TGGAGTCTACAGAAGCAGGCAGG - Intergenic
1015379117 6:132546712-132546734 ATTATTTTCCAGAAGGAGGCAGG + Intergenic
1016599057 6:145836105-145836127 CTTTTTTTTCAGAAGGAGGCAGG - Intergenic
1019801729 7:3092761-3092783 CTGACCCTACAGCAGGACGCAGG + Intergenic
1021450753 7:20781946-20781968 CTCAGTCTCCAGAAGGAGTCAGG - Intergenic
1023927053 7:44677028-44677050 CTATTTCTACACAAGCAGGCAGG - Intronic
1024264874 7:47598796-47598818 CTGAAGCTGTAGAAGGAGGCAGG - Intergenic
1024704451 7:51941804-51941826 TGGAGTCTACAGAAGCAGGCAGG - Intergenic
1025172417 7:56771613-56771635 CTGATTCTCAAGAAGGAGGAAGG + Intergenic
1027872990 7:83732933-83732955 CATAATCTACAGAAGGAGGTAGG + Intergenic
1028159087 7:87465442-87465464 CAGAGTCTACAGAGGCAGGCAGG - Intronic
1028333673 7:89625788-89625810 TTGGTTCTCCAGATGGAGGCTGG - Intergenic
1028358934 7:89944309-89944331 CTTAGTCTACAGAAAGAGGTAGG - Intergenic
1028386691 7:90262009-90262031 CAGATTCTATAAAACGAGGCTGG - Exonic
1029815423 7:103089664-103089686 CATATTCCACTGAAGGAGGCTGG + Intronic
1030729705 7:112972046-112972068 CTCTTTCTTCACAAGGAGGCAGG - Intergenic
1034762300 7:153684366-153684388 CTTATTTTACAGATGAAGGCAGG + Intergenic
1039146328 8:34451338-34451360 TGGAGTCTACAGAAGCAGGCAGG + Intergenic
1039890719 8:41683673-41683695 CTGATTTTACAGAAGGGGAGAGG + Intronic
1040427419 8:47303044-47303066 GTGAGTCTACAGAGGCAGGCAGG + Intronic
1041191019 8:55354306-55354328 CTGATGCTACTGGAGCAGGCTGG + Intronic
1041665897 8:60444586-60444608 TGGAGTCTACAGAGGGAGGCAGG + Intergenic
1041683054 8:60612818-60612840 GTGATGCTATAGAAAGAGGCGGG + Intronic
1041772006 8:61481739-61481761 TGGAATCTACAGAGGGAGGCAGG - Intronic
1042698274 8:71582145-71582167 TGGAGTCTACAGAAGCAGGCAGG - Intronic
1043279454 8:78445380-78445402 TGGAGTCTACAGAAGCAGGCAGG - Intergenic
1043535987 8:81205023-81205045 TGGAGTCTACAGAAGCAGGCAGG + Intergenic
1043747812 8:83898288-83898310 TGGAGTCTACAGAAGCAGGCAGG - Intergenic
1044392583 8:91669352-91669374 CTGAGTCTAGAGAAGATGGCTGG - Intergenic
1044816995 8:96123870-96123892 TGGATTCCAAAGAAGGAGGCAGG - Intergenic
1049732040 8:144183502-144183524 CTGATTGATCAGAAGGATGCTGG - Intronic
1049993312 9:1010504-1010526 GTGATTCAAGAAAAGGAGGCTGG + Intergenic
1050034837 9:1424344-1424366 CGGAGTCTACAGAGGCAGGCAGG + Intergenic
1050488076 9:6156277-6156299 CTAATTCTACAGAAATAGGAAGG + Intergenic
1051156829 9:14157403-14157425 CTGTTTCTAAAGAAGGTGGGTGG - Intronic
1052696803 9:31888749-31888771 CGGAGTCTACAGAGGCAGGCAGG + Intergenic
1054864893 9:69989964-69989986 CTGATTCTGTAGGAGGAAGCAGG - Intergenic
1057606263 9:96499629-96499651 CTTACCCTACAGAAGGGGGCTGG + Intronic
1060235758 9:121861616-121861638 CTTAGTCTCCAGAAGGAGGAGGG + Intronic
1060306150 9:122414244-122414266 TTGAGTCTACAGAGGCAGGCAGG + Intergenic
1060949906 9:127594906-127594928 CTGATTCTGTAGGGGGAGGCGGG + Intergenic
1061518506 9:131103491-131103513 CTAATTGCACAGAAGGAGCCTGG - Intronic
1061725311 9:132579317-132579339 CTGTTCCCACAGCAGGAGGCAGG - Intergenic
1186331706 X:8541496-8541518 CTGATTTTATATAAGGCGGCTGG + Intronic
1188043967 X:25404199-25404221 CTGAGTCTACAGAGGCAGGCAGG + Intergenic
1188482564 X:30650474-30650496 CTGATTCTACCACAGGAGGCTGG + Intergenic
1189052071 X:37656344-37656366 TTGAGTCTAGAGAAAGAGGCAGG - Intronic
1189357398 X:40321518-40321540 CTGCTTCTAATGTAGGAGGCTGG - Intergenic
1190066062 X:47242523-47242545 GTGAGACTGCAGAAGGAGGCTGG + Intronic
1191589898 X:62870816-62870838 TGGAGTCTACAGAAGCAGGCAGG + Intergenic
1191702966 X:64063087-64063109 TGGATTCTACAGAGGCAGGCAGG + Intergenic
1191782029 X:64879218-64879240 TTGAGTCTACAGAGGCAGGCAGG - Intergenic
1192057510 X:67787356-67787378 CTGATTATAGAGAAAGAGGCTGG - Intergenic
1193387937 X:80893220-80893242 TGGATTCTACAGAGGCAGGCAGG + Intergenic
1195462693 X:105145432-105145454 TTGAGTACACAGAAGGAGGCAGG + Intronic
1195587211 X:106578741-106578763 TGGAGTCTACAGATGGAGGCAGG + Intergenic
1195645674 X:107228394-107228416 ATGATTTTTGAGAAGGAGGCAGG + Intronic
1196853590 X:119961995-119962017 TGGAGTCTACAGAGGGAGGCAGG - Intergenic
1197737106 X:129859244-129859266 TGGAGTCTACAGAAGCAGGCAGG + Intergenic
1197915014 X:131525008-131525030 TTGAGTCTACAGAGGCAGGCAGG - Intergenic
1198166426 X:134062252-134062274 TTGAGTCTACAGAGGCAGGCCGG + Intergenic
1198581844 X:138073937-138073959 CAGAGTCTACAGAGGCAGGCAGG - Intergenic
1200805428 Y:7428510-7428532 TGGAGTCTACAGAGGGAGGCAGG - Intergenic
1200956194 Y:8948644-8948666 TAGAGTCTACAGAAGCAGGCAGG + Intergenic
1201247071 Y:12015223-12015245 TGGAGTCTACAGAAGCAGGCAGG + Intergenic
1202105040 Y:21354942-21354964 TGGAGTCTACAGAAGCAGGCAGG - Intergenic
1202356704 Y:24059153-24059175 CAGAGTCTACAGAAGCTGGCAGG - Intergenic
1202361489 Y:24115187-24115209 CAGAGTCTACAGAGGCAGGCAGG + Intergenic
1202363584 Y:24137913-24137935 CAGAGTCTACAGAGGCAGGCAGG - Intergenic
1202507196 Y:25532204-25532226 CAGAGTCTACAGAGGCAGGCAGG + Intergenic
1202509289 Y:25554932-25554954 CAGAGTCTACAGAGGCAGGCAGG - Intergenic
1202514074 Y:25610957-25610979 CAGAGTCTACAGAAGCTGGCAGG + Intergenic