ID: 906066224

View in Genome Browser
Species Human (GRCh38)
Location 1:42982444-42982466
Sequence CTCCTGAGGAGCAAATTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906066224_906066235 11 Left 906066224 1:42982444-42982466 CCTCCCAATTTGCTCCTCAGGAG No data
Right 906066235 1:42982478-42982500 GCTATCCCAGGCTCTTGGTGGGG No data
906066224_906066229 -1 Left 906066224 1:42982444-42982466 CCTCCCAATTTGCTCCTCAGGAG No data
Right 906066229 1:42982466-42982488 GCCCAGGCATAAGCTATCCCAGG No data
906066224_906066234 10 Left 906066224 1:42982444-42982466 CCTCCCAATTTGCTCCTCAGGAG No data
Right 906066234 1:42982477-42982499 AGCTATCCCAGGCTCTTGGTGGG No data
906066224_906066232 6 Left 906066224 1:42982444-42982466 CCTCCCAATTTGCTCCTCAGGAG No data
Right 906066232 1:42982473-42982495 CATAAGCTATCCCAGGCTCTTGG No data
906066224_906066233 9 Left 906066224 1:42982444-42982466 CCTCCCAATTTGCTCCTCAGGAG No data
Right 906066233 1:42982476-42982498 AAGCTATCCCAGGCTCTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906066224 Original CRISPR CTCCTGAGGAGCAAATTGGG AGG (reversed) Intergenic
No off target data available for this crispr