ID: 906068057

View in Genome Browser
Species Human (GRCh38)
Location 1:42996407-42996429
Sequence AGGGTGGAGGTCAGAGTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906068057_906068072 30 Left 906068057 1:42996407-42996429 CCCCTGACTCTGACCTCCACCCT No data
Right 906068072 1:42996460-42996482 TGATGGCCACATCTGGTGCCAGG No data
906068057_906068062 -7 Left 906068057 1:42996407-42996429 CCCCTGACTCTGACCTCCACCCT No data
Right 906068062 1:42996423-42996445 CCACCCTCTCATTCCTCTCCAGG No data
906068057_906068063 -6 Left 906068057 1:42996407-42996429 CCCCTGACTCTGACCTCCACCCT No data
Right 906068063 1:42996424-42996446 CACCCTCTCATTCCTCTCCAGGG No data
906068057_906068071 23 Left 906068057 1:42996407-42996429 CCCCTGACTCTGACCTCCACCCT No data
Right 906068071 1:42996453-42996475 CGCACTCTGATGGCCACATCTGG No data
906068057_906068068 13 Left 906068057 1:42996407-42996429 CCCCTGACTCTGACCTCCACCCT No data
Right 906068068 1:42996443-42996465 AGGGCAGTCCCGCACTCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906068057 Original CRISPR AGGGTGGAGGTCAGAGTCAG GGG (reversed) Intergenic
No off target data available for this crispr