ID: 906068059

View in Genome Browser
Species Human (GRCh38)
Location 1:42996409-42996431
Sequence AGAGGGTGGAGGTCAGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906068059_906068072 28 Left 906068059 1:42996409-42996431 CCTGACTCTGACCTCCACCCTCT No data
Right 906068072 1:42996460-42996482 TGATGGCCACATCTGGTGCCAGG No data
906068059_906068063 -8 Left 906068059 1:42996409-42996431 CCTGACTCTGACCTCCACCCTCT No data
Right 906068063 1:42996424-42996446 CACCCTCTCATTCCTCTCCAGGG No data
906068059_906068071 21 Left 906068059 1:42996409-42996431 CCTGACTCTGACCTCCACCCTCT No data
Right 906068071 1:42996453-42996475 CGCACTCTGATGGCCACATCTGG No data
906068059_906068068 11 Left 906068059 1:42996409-42996431 CCTGACTCTGACCTCCACCCTCT No data
Right 906068068 1:42996443-42996465 AGGGCAGTCCCGCACTCTGATGG No data
906068059_906068062 -9 Left 906068059 1:42996409-42996431 CCTGACTCTGACCTCCACCCTCT No data
Right 906068062 1:42996423-42996445 CCACCCTCTCATTCCTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906068059 Original CRISPR AGAGGGTGGAGGTCAGAGTC AGG (reversed) Intergenic