ID: 906068061 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:42996423-42996445 |
| Sequence | CCTGGAGAGGAATGAGAGGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 906068061_906068072 | 14 | Left | 906068061 | 1:42996423-42996445 | CCACCCTCTCATTCCTCTCCAGG | No data | ||
| Right | 906068072 | 1:42996460-42996482 | TGATGGCCACATCTGGTGCCAGG | No data | ||||
| 906068061_906068071 | 7 | Left | 906068061 | 1:42996423-42996445 | CCACCCTCTCATTCCTCTCCAGG | No data | ||
| Right | 906068071 | 1:42996453-42996475 | CGCACTCTGATGGCCACATCTGG | No data | ||||
| 906068061_906068068 | -3 | Left | 906068061 | 1:42996423-42996445 | CCACCCTCTCATTCCTCTCCAGG | No data | ||
| Right | 906068068 | 1:42996443-42996465 | AGGGCAGTCCCGCACTCTGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 906068061 | Original CRISPR | CCTGGAGAGGAATGAGAGGG TGG (reversed) | Intergenic | ||