ID: 906068061

View in Genome Browser
Species Human (GRCh38)
Location 1:42996423-42996445
Sequence CCTGGAGAGGAATGAGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906068061_906068068 -3 Left 906068061 1:42996423-42996445 CCACCCTCTCATTCCTCTCCAGG No data
Right 906068068 1:42996443-42996465 AGGGCAGTCCCGCACTCTGATGG No data
906068061_906068071 7 Left 906068061 1:42996423-42996445 CCACCCTCTCATTCCTCTCCAGG No data
Right 906068071 1:42996453-42996475 CGCACTCTGATGGCCACATCTGG No data
906068061_906068072 14 Left 906068061 1:42996423-42996445 CCACCCTCTCATTCCTCTCCAGG No data
Right 906068072 1:42996460-42996482 TGATGGCCACATCTGGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906068061 Original CRISPR CCTGGAGAGGAATGAGAGGG TGG (reversed) Intergenic
No off target data available for this crispr