ID: 906068065

View in Genome Browser
Species Human (GRCh38)
Location 1:42996427-42996449
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906068065_906068068 -7 Left 906068065 1:42996427-42996449 CCTCTCATTCCTCTCCAGGGCAG No data
Right 906068068 1:42996443-42996465 AGGGCAGTCCCGCACTCTGATGG No data
906068065_906068072 10 Left 906068065 1:42996427-42996449 CCTCTCATTCCTCTCCAGGGCAG No data
Right 906068072 1:42996460-42996482 TGATGGCCACATCTGGTGCCAGG No data
906068065_906068071 3 Left 906068065 1:42996427-42996449 CCTCTCATTCCTCTCCAGGGCAG No data
Right 906068071 1:42996453-42996475 CGCACTCTGATGGCCACATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906068065 Original CRISPR CTGCCCTGGAGAGGAATGAG AGG (reversed) Intergenic