ID: 906068068

View in Genome Browser
Species Human (GRCh38)
Location 1:42996443-42996465
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906068060_906068068 0 Left 906068060 1:42996420-42996442 CCTCCACCCTCTCATTCCTCTCC No data
Right 906068068 1:42996443-42996465 AGGGCAGTCCCGCACTCTGATGG No data
906068057_906068068 13 Left 906068057 1:42996407-42996429 CCCCTGACTCTGACCTCCACCCT No data
Right 906068068 1:42996443-42996465 AGGGCAGTCCCGCACTCTGATGG No data
906068059_906068068 11 Left 906068059 1:42996409-42996431 CCTGACTCTGACCTCCACCCTCT No data
Right 906068068 1:42996443-42996465 AGGGCAGTCCCGCACTCTGATGG No data
906068061_906068068 -3 Left 906068061 1:42996423-42996445 CCACCCTCTCATTCCTCTCCAGG No data
Right 906068068 1:42996443-42996465 AGGGCAGTCCCGCACTCTGATGG No data
906068064_906068068 -6 Left 906068064 1:42996426-42996448 CCCTCTCATTCCTCTCCAGGGCA No data
Right 906068068 1:42996443-42996465 AGGGCAGTCCCGCACTCTGATGG No data
906068065_906068068 -7 Left 906068065 1:42996427-42996449 CCTCTCATTCCTCTCCAGGGCAG No data
Right 906068068 1:42996443-42996465 AGGGCAGTCCCGCACTCTGATGG No data
906068058_906068068 12 Left 906068058 1:42996408-42996430 CCCTGACTCTGACCTCCACCCTC No data
Right 906068068 1:42996443-42996465 AGGGCAGTCCCGCACTCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type