ID: 906068072

View in Genome Browser
Species Human (GRCh38)
Location 1:42996460-42996482
Sequence TGATGGCCACATCTGGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906068057_906068072 30 Left 906068057 1:42996407-42996429 CCCCTGACTCTGACCTCCACCCT No data
Right 906068072 1:42996460-42996482 TGATGGCCACATCTGGTGCCAGG No data
906068064_906068072 11 Left 906068064 1:42996426-42996448 CCCTCTCATTCCTCTCCAGGGCA No data
Right 906068072 1:42996460-42996482 TGATGGCCACATCTGGTGCCAGG No data
906068060_906068072 17 Left 906068060 1:42996420-42996442 CCTCCACCCTCTCATTCCTCTCC No data
Right 906068072 1:42996460-42996482 TGATGGCCACATCTGGTGCCAGG No data
906068058_906068072 29 Left 906068058 1:42996408-42996430 CCCTGACTCTGACCTCCACCCTC No data
Right 906068072 1:42996460-42996482 TGATGGCCACATCTGGTGCCAGG No data
906068066_906068072 1 Left 906068066 1:42996436-42996458 CCTCTCCAGGGCAGTCCCGCACT No data
Right 906068072 1:42996460-42996482 TGATGGCCACATCTGGTGCCAGG No data
906068067_906068072 -4 Left 906068067 1:42996441-42996463 CCAGGGCAGTCCCGCACTCTGAT No data
Right 906068072 1:42996460-42996482 TGATGGCCACATCTGGTGCCAGG No data
906068061_906068072 14 Left 906068061 1:42996423-42996445 CCACCCTCTCATTCCTCTCCAGG No data
Right 906068072 1:42996460-42996482 TGATGGCCACATCTGGTGCCAGG No data
906068065_906068072 10 Left 906068065 1:42996427-42996449 CCTCTCATTCCTCTCCAGGGCAG No data
Right 906068072 1:42996460-42996482 TGATGGCCACATCTGGTGCCAGG No data
906068059_906068072 28 Left 906068059 1:42996409-42996431 CCTGACTCTGACCTCCACCCTCT No data
Right 906068072 1:42996460-42996482 TGATGGCCACATCTGGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906068072 Original CRISPR TGATGGCCACATCTGGTGCC AGG Intergenic