ID: 906068285

View in Genome Browser
Species Human (GRCh38)
Location 1:42998342-42998364
Sequence CCCGCGCCTGGCCTTCCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906068280_906068285 6 Left 906068280 1:42998313-42998335 CCAAAGTGCTGGGATTACAGGCA No data
Right 906068285 1:42998342-42998364 CCCGCGCCTGGCCTTCCATGTGG No data
906068273_906068285 23 Left 906068273 1:42998296-42998318 CCACGAGCCTCGGCCTCCCAAAG No data
Right 906068285 1:42998342-42998364 CCCGCGCCTGGCCTTCCATGTGG No data
906068279_906068285 7 Left 906068279 1:42998312-42998334 CCCAAAGTGCTGGGATTACAGGC No data
Right 906068285 1:42998342-42998364 CCCGCGCCTGGCCTTCCATGTGG No data
906068275_906068285 16 Left 906068275 1:42998303-42998325 CCTCGGCCTCCCAAAGTGCTGGG No data
Right 906068285 1:42998342-42998364 CCCGCGCCTGGCCTTCCATGTGG No data
906068277_906068285 10 Left 906068277 1:42998309-42998331 CCTCCCAAAGTGCTGGGATTACA No data
Right 906068285 1:42998342-42998364 CCCGCGCCTGGCCTTCCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906068285 Original CRISPR CCCGCGCCTGGCCTTCCATG TGG Intergenic