ID: 906068285

View in Genome Browser
Species Human (GRCh38)
Location 1:42998342-42998364
Sequence CCCGCGCCTGGCCTTCCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906068277_906068285 10 Left 906068277 1:42998309-42998331 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 906068285 1:42998342-42998364 CCCGCGCCTGGCCTTCCATGTGG No data
906068275_906068285 16 Left 906068275 1:42998303-42998325 CCTCGGCCTCCCAAAGTGCTGGG 0: 114360
1: 259489
2: 214307
3: 130302
4: 170463
Right 906068285 1:42998342-42998364 CCCGCGCCTGGCCTTCCATGTGG No data
906068273_906068285 23 Left 906068273 1:42998296-42998318 CCACGAGCCTCGGCCTCCCAAAG 0: 10
1: 1915
2: 74767
3: 178881
4: 182205
Right 906068285 1:42998342-42998364 CCCGCGCCTGGCCTTCCATGTGG No data
906068280_906068285 6 Left 906068280 1:42998313-42998335 CCAAAGTGCTGGGATTACAGGCA 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714
Right 906068285 1:42998342-42998364 CCCGCGCCTGGCCTTCCATGTGG No data
906068279_906068285 7 Left 906068279 1:42998312-42998334 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 906068285 1:42998342-42998364 CCCGCGCCTGGCCTTCCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906068285 Original CRISPR CCCGCGCCTGGCCTTCCATG TGG Intergenic
No off target data available for this crispr