ID: 906069525

View in Genome Browser
Species Human (GRCh38)
Location 1:43007100-43007122
Sequence AAAAAGCAGTCTTGTCGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906069525_906069530 2 Left 906069525 1:43007100-43007122 CCCGGCCGACAAGACTGCTTTTT No data
Right 906069530 1:43007125-43007147 CCTTGTTGGAAAGAGCCACTTGG No data
906069525_906069534 21 Left 906069525 1:43007100-43007122 CCCGGCCGACAAGACTGCTTTTT No data
Right 906069534 1:43007144-43007166 TTGGAGATCAGCCCGTCTAGGGG No data
906069525_906069533 20 Left 906069525 1:43007100-43007122 CCCGGCCGACAAGACTGCTTTTT No data
Right 906069533 1:43007143-43007165 CTTGGAGATCAGCCCGTCTAGGG No data
906069525_906069532 19 Left 906069525 1:43007100-43007122 CCCGGCCGACAAGACTGCTTTTT No data
Right 906069532 1:43007142-43007164 ACTTGGAGATCAGCCCGTCTAGG No data
906069525_906069535 22 Left 906069525 1:43007100-43007122 CCCGGCCGACAAGACTGCTTTTT No data
Right 906069535 1:43007145-43007167 TGGAGATCAGCCCGTCTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906069525 Original CRISPR AAAAAGCAGTCTTGTCGGCC GGG (reversed) Intergenic
No off target data available for this crispr