ID: 906071325

View in Genome Browser
Species Human (GRCh38)
Location 1:43018871-43018893
Sequence TGGTAGGTCCAGAATTCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906071320_906071325 19 Left 906071320 1:43018829-43018851 CCGCAGAAAGGCAACGATGTTGG No data
Right 906071325 1:43018871-43018893 TGGTAGGTCCAGAATTCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906071325 Original CRISPR TGGTAGGTCCAGAATTCCAG TGG Intergenic
No off target data available for this crispr