ID: 906074331

View in Genome Browser
Species Human (GRCh38)
Location 1:43041085-43041107
Sequence CACCAATAACAATGAGGCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906074329_906074331 -10 Left 906074329 1:43041072-43041094 CCTTATAAAGTGGCACCAATAAC No data
Right 906074331 1:43041085-43041107 CACCAATAACAATGAGGCTATGG No data
906074323_906074331 28 Left 906074323 1:43041034-43041056 CCAGGGCCTTACACTTCTCTTTG No data
Right 906074331 1:43041085-43041107 CACCAATAACAATGAGGCTATGG No data
906074328_906074331 -4 Left 906074328 1:43041066-43041088 CCTCTACCTTATAAAGTGGCACC No data
Right 906074331 1:43041085-43041107 CACCAATAACAATGAGGCTATGG No data
906074326_906074331 2 Left 906074326 1:43041060-43041082 CCATGACCTCTACCTTATAAAGT No data
Right 906074331 1:43041085-43041107 CACCAATAACAATGAGGCTATGG No data
906074324_906074331 22 Left 906074324 1:43041040-43041062 CCTTACACTTCTCTTTGAGCCCA No data
Right 906074331 1:43041085-43041107 CACCAATAACAATGAGGCTATGG No data
906074325_906074331 3 Left 906074325 1:43041059-43041081 CCCATGACCTCTACCTTATAAAG No data
Right 906074331 1:43041085-43041107 CACCAATAACAATGAGGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906074331 Original CRISPR CACCAATAACAATGAGGCTA TGG Intergenic
No off target data available for this crispr