ID: 906074845

View in Genome Browser
Species Human (GRCh38)
Location 1:43044447-43044469
Sequence AATTAAGCCCAGATGAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906074841_906074845 8 Left 906074841 1:43044416-43044438 CCGTCTAGTTTCTGCAGGGGCCA No data
Right 906074845 1:43044447-43044469 AATTAAGCCCAGATGAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906074845 Original CRISPR AATTAAGCCCAGATGAGGCT GGG Intergenic
No off target data available for this crispr