ID: 906074965

View in Genome Browser
Species Human (GRCh38)
Location 1:43045403-43045425
Sequence GTGTGGAAACAGATGGGGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906074960_906074965 5 Left 906074960 1:43045375-43045397 CCGGCAGAACTTGGTGTTGGAAA No data
Right 906074965 1:43045403-43045425 GTGTGGAAACAGATGGGGTATGG No data
906074955_906074965 27 Left 906074955 1:43045353-43045375 CCTGACACTTGGGCCATACACTC No data
Right 906074965 1:43045403-43045425 GTGTGGAAACAGATGGGGTATGG No data
906074957_906074965 14 Left 906074957 1:43045366-43045388 CCATACACTCCGGCAGAACTTGG No data
Right 906074965 1:43045403-43045425 GTGTGGAAACAGATGGGGTATGG No data
906074954_906074965 28 Left 906074954 1:43045352-43045374 CCCTGACACTTGGGCCATACACT No data
Right 906074965 1:43045403-43045425 GTGTGGAAACAGATGGGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906074965 Original CRISPR GTGTGGAAACAGATGGGGTA TGG Intergenic
No off target data available for this crispr