ID: 906075511

View in Genome Browser
Species Human (GRCh38)
Location 1:43049188-43049210
Sequence TGGAGCTATCAGGCATTACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906075511_906075517 10 Left 906075511 1:43049188-43049210 CCCAGTAATGCCTGATAGCTCCA No data
Right 906075517 1:43049221-43049243 CTTCCCAAGAGACCCGGCCTTGG No data
906075511_906075516 4 Left 906075511 1:43049188-43049210 CCCAGTAATGCCTGATAGCTCCA No data
Right 906075516 1:43049215-43049237 GGCTTTCTTCCCAAGAGACCCGG No data
906075511_906075523 23 Left 906075511 1:43049188-43049210 CCCAGTAATGCCTGATAGCTCCA No data
Right 906075523 1:43049234-43049256 CCGGCCTTGGCCCGGTCCTCTGG No data
906075511_906075520 15 Left 906075511 1:43049188-43049210 CCCAGTAATGCCTGATAGCTCCA No data
Right 906075520 1:43049226-43049248 CAAGAGACCCGGCCTTGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906075511 Original CRISPR TGGAGCTATCAGGCATTACT GGG (reversed) Intergenic
No off target data available for this crispr