ID: 906075512

View in Genome Browser
Species Human (GRCh38)
Location 1:43049189-43049211
Sequence GTGGAGCTATCAGGCATTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906075512_906075523 22 Left 906075512 1:43049189-43049211 CCAGTAATGCCTGATAGCTCCAC No data
Right 906075523 1:43049234-43049256 CCGGCCTTGGCCCGGTCCTCTGG No data
906075512_906075516 3 Left 906075512 1:43049189-43049211 CCAGTAATGCCTGATAGCTCCAC No data
Right 906075516 1:43049215-43049237 GGCTTTCTTCCCAAGAGACCCGG No data
906075512_906075520 14 Left 906075512 1:43049189-43049211 CCAGTAATGCCTGATAGCTCCAC No data
Right 906075520 1:43049226-43049248 CAAGAGACCCGGCCTTGGCCCGG No data
906075512_906075517 9 Left 906075512 1:43049189-43049211 CCAGTAATGCCTGATAGCTCCAC No data
Right 906075517 1:43049221-43049243 CTTCCCAAGAGACCCGGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906075512 Original CRISPR GTGGAGCTATCAGGCATTAC TGG (reversed) Intergenic
No off target data available for this crispr