ID: 906075516

View in Genome Browser
Species Human (GRCh38)
Location 1:43049215-43049237
Sequence GGCTTTCTTCCCAAGAGACC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906075509_906075516 6 Left 906075509 1:43049186-43049208 CCCCCAGTAATGCCTGATAGCTC No data
Right 906075516 1:43049215-43049237 GGCTTTCTTCCCAAGAGACCCGG No data
906075510_906075516 5 Left 906075510 1:43049187-43049209 CCCCAGTAATGCCTGATAGCTCC No data
Right 906075516 1:43049215-43049237 GGCTTTCTTCCCAAGAGACCCGG No data
906075511_906075516 4 Left 906075511 1:43049188-43049210 CCCAGTAATGCCTGATAGCTCCA No data
Right 906075516 1:43049215-43049237 GGCTTTCTTCCCAAGAGACCCGG No data
906075514_906075516 -6 Left 906075514 1:43049198-43049220 CCTGATAGCTCCACATTGGCTTT No data
Right 906075516 1:43049215-43049237 GGCTTTCTTCCCAAGAGACCCGG No data
906075512_906075516 3 Left 906075512 1:43049189-43049211 CCAGTAATGCCTGATAGCTCCAC No data
Right 906075516 1:43049215-43049237 GGCTTTCTTCCCAAGAGACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906075516 Original CRISPR GGCTTTCTTCCCAAGAGACC CGG Intergenic
No off target data available for this crispr