ID: 906078716

View in Genome Browser
Species Human (GRCh38)
Location 1:43069830-43069852
Sequence CTGAATGTGCAGAGGAATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906078710_906078716 7 Left 906078710 1:43069800-43069822 CCCAACAGAGCCTGAATGCCATT No data
Right 906078716 1:43069830-43069852 CTGAATGTGCAGAGGAATGTAGG No data
906078709_906078716 8 Left 906078709 1:43069799-43069821 CCCCAACAGAGCCTGAATGCCAT No data
Right 906078716 1:43069830-43069852 CTGAATGTGCAGAGGAATGTAGG No data
906078711_906078716 6 Left 906078711 1:43069801-43069823 CCAACAGAGCCTGAATGCCATTT No data
Right 906078716 1:43069830-43069852 CTGAATGTGCAGAGGAATGTAGG No data
906078712_906078716 -3 Left 906078712 1:43069810-43069832 CCTGAATGCCATTTTGCTGCCTG No data
Right 906078716 1:43069830-43069852 CTGAATGTGCAGAGGAATGTAGG No data
906078708_906078716 9 Left 906078708 1:43069798-43069820 CCCCCAACAGAGCCTGAATGCCA No data
Right 906078716 1:43069830-43069852 CTGAATGTGCAGAGGAATGTAGG No data
906078707_906078716 12 Left 906078707 1:43069795-43069817 CCGCCCCCAACAGAGCCTGAATG No data
Right 906078716 1:43069830-43069852 CTGAATGTGCAGAGGAATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906078716 Original CRISPR CTGAATGTGCAGAGGAATGT AGG Intergenic
No off target data available for this crispr