ID: 906079116

View in Genome Browser
Species Human (GRCh38)
Location 1:43071924-43071946
Sequence CCTTCTGGGGATGGGATGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906079109_906079116 -2 Left 906079109 1:43071903-43071925 CCAGACAGGGGAGGTTCGGAGCC No data
Right 906079116 1:43071924-43071946 CCTTCTGGGGATGGGATGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906079116 Original CRISPR CCTTCTGGGGATGGGATGAC AGG Intergenic
No off target data available for this crispr