ID: 906087569

View in Genome Browser
Species Human (GRCh38)
Location 1:43148879-43148901
Sequence AAGCAGGAACAAGTGGGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 280}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906087569_906087574 4 Left 906087569 1:43148879-43148901 CCCTGACCCACTTGTTCCTGCTT 0: 1
1: 0
2: 1
3: 44
4: 280
Right 906087574 1:43148906-43148928 GAAAGACACCATCATGCATATGG 0: 1
1: 0
2: 0
3: 12
4: 202
906087569_906087576 27 Left 906087569 1:43148879-43148901 CCCTGACCCACTTGTTCCTGCTT 0: 1
1: 0
2: 1
3: 44
4: 280
Right 906087576 1:43148929-43148951 ATTCCTCTCTGCCTCTGCTCAGG 0: 1
1: 0
2: 4
3: 38
4: 415

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906087569 Original CRISPR AAGCAGGAACAAGTGGGTCA GGG (reversed) Intronic
901948771 1:12724900-12724922 AAGCAGGAGCAGGTGAGTCAGGG + Intronic
902691765 1:18114276-18114298 GAGCAGGGTCTAGTGGGTCAGGG - Intronic
904399679 1:30247981-30248003 AAGCTGGAAGAAGTGGGTGCAGG - Intergenic
904463071 1:30692037-30692059 AAACAGAAAGAAGTGCGTCAGGG + Intergenic
904895124 1:33811388-33811410 CAGGAGGACCAAGGGGGTCACGG - Intronic
906087569 1:43148879-43148901 AAGCAGGAACAAGTGGGTCAGGG - Intronic
906150215 1:43583266-43583288 CAGCAGGAACATGCAGGTCAGGG - Intronic
906183270 1:43839833-43839855 AAGCAGGAGCAAGTGAGTGAAGG + Intronic
906459540 1:46026887-46026909 AAGGAGGAACGTGAGGGTCAGGG - Intronic
907150182 1:52278553-52278575 AAACAAATACAAGTGGGTCAGGG - Exonic
907694965 1:56715823-56715845 AACCAGCAACAAGTGGCTTATGG + Intergenic
907699948 1:56776384-56776406 AAGGTGGAACCAGTGGATCAGGG + Intronic
907848050 1:58227691-58227713 AGGCAGGGAGAAGTAGGTCATGG + Intronic
908384040 1:63623561-63623583 AACCAGGAACAAGTGGATTACGG + Exonic
908539881 1:65112187-65112209 GAGCAGGAACAAGGGGGTGGGGG + Intergenic
908580581 1:65512067-65512089 GAGCAGGAACAAGAGGGTGAAGG + Intronic
909258494 1:73455518-73455540 AAGCAGGGACAAGCTGTTCAAGG - Intergenic
909533410 1:76706848-76706870 AAGCATGAACAACTGTTTCAAGG + Intergenic
910047851 1:82939234-82939256 AAGCTGGAACCAGTTTGTCAGGG - Intergenic
910877955 1:91895304-91895326 AAGCAGGAGCAAGAGAGTGAGGG - Intronic
917488873 1:175480239-175480261 CAGCACCAACAAGTGGCTCAGGG + Intronic
918083465 1:181224978-181225000 AAGCAGGGAGAAGTGGGTGATGG + Intergenic
919074597 1:192798054-192798076 AAACAGGAACAAGAGGGAGAGGG - Intergenic
921183685 1:212652156-212652178 AAGCAGGAAGAAAGGGGCCAGGG - Intergenic
921482144 1:215675692-215675714 AATAAGGAACAAGGGGGTGAAGG - Intronic
922080147 1:222287827-222287849 AAGCAGGCATAAGTTGGACATGG - Intergenic
922189807 1:223308332-223308354 GAGCAGGAACAAGAGGGTGGGGG - Intronic
923201568 1:231717557-231717579 AAGGTAGATCAAGTGGGTCAAGG + Intronic
923774236 1:236964218-236964240 AATCAGGGTCAAGTGGGCCAGGG - Intergenic
1063032668 10:2251327-2251349 AAGAAAGAACAAATGGATCAAGG - Intergenic
1063121700 10:3109327-3109349 AACCAGGTCCATGTGGGTCAGGG - Intronic
1065804276 10:29380634-29380656 AAGCAGAAACCACTGGGTGAGGG + Intergenic
1065944906 10:30597386-30597408 AAGCAGAAACCACTGGGTGAGGG - Intergenic
1066088443 10:31994123-31994145 AAGCAGGAACAAGAGGCTGAGGG + Intergenic
1066124518 10:32327319-32327341 AAACAGGAAGAAGTTGGTCAAGG + Intronic
1067049134 10:43001961-43001983 AGCCAGGAAAAAGTGGGTCAGGG + Intergenic
1067196770 10:44126602-44126624 AAGCAGGAACAATTTTGTCAAGG - Intergenic
1067248988 10:44571480-44571502 AAGCAGAAGCAAGGGGGACATGG + Intergenic
1068403014 10:56554623-56554645 AAGCAGTTACAAGTGGCTGAAGG - Intergenic
1068485068 10:57647715-57647737 AACCATCAACAAGTGGGTGAAGG - Intergenic
1071474873 10:86017554-86017576 GAGCAGGCACAACTGGGTCATGG + Intronic
1072553446 10:96496349-96496371 TAGCTGGAACAAATGGGTAATGG - Intronic
1073304534 10:102492608-102492630 GAGCAGGAATAAGAGAGTCAAGG - Intronic
1074312364 10:112333170-112333192 GAGAAGGAATAAGTGGGTGAAGG + Intergenic
1075275259 10:121087005-121087027 AAACAGATACAAGTGGATCAGGG - Intergenic
1075619472 10:123915173-123915195 AGGCAGGAGCAAGTGTGTGAAGG - Intronic
1075920690 10:126210491-126210513 AAGGTGGAACAAGTGGGGTAGGG + Intronic
1077381373 11:2240620-2240642 AAGCAGGAGCAAGAGAGACAGGG + Intergenic
1078268596 11:9773801-9773823 AAGCAGGAGCAAGAGAGTAAGGG + Intergenic
1079017463 11:16881438-16881460 GAGCAGGAACAAGTGGCTGCTGG - Intronic
1082685668 11:56236209-56236231 AAGCAAGAAGAAGTCAGTCATGG - Intergenic
1082878990 11:58019722-58019744 AGGCAGGAACCAGTGGGGCCTGG + Intergenic
1083539345 11:63501576-63501598 AAGCAGGAAGGAGGGGGGCAGGG - Intergenic
1085898683 11:80670723-80670745 AAGCAGCAGCAAGTGGACCACGG + Intergenic
1087921857 11:103875938-103875960 AAGTAGGAGGAAGTGGGGCAAGG + Intergenic
1088741435 11:112770579-112770601 AAACAAGAACAAGTGGGAGATGG - Intergenic
1088973825 11:114797060-114797082 AGGCAGGAAGCAATGGGTCATGG + Intergenic
1089992598 11:122875621-122875643 AAGAAGGAATTAGTGGGGCATGG + Intergenic
1090206875 11:124889717-124889739 AAAAAGGAACAAGCAGGTCAAGG + Intronic
1090333980 11:125950781-125950803 GAGCAGGGAGAAGTGGGTTAGGG - Intergenic
1092260654 12:6951788-6951810 AACCAGGAATGAGTGGTTCAGGG - Intronic
1093486756 12:19661167-19661189 AGGAAGGAACAAGTGAGGCAGGG + Intronic
1099104191 12:78479591-78479613 AAGGAAGAATAAGTGTGTCAGGG + Intergenic
1099346413 12:81505713-81505735 AAGCTGGTACATGTGGCTCAGGG - Intronic
1101003185 12:100376549-100376571 AAGCAAGAACAAATTGGCCAAGG - Intronic
1101605261 12:106243637-106243659 CAGCAGGCACAAGTGGGTCCTGG - Intronic
1101793371 12:107951178-107951200 AAGCAGGAGCAGGTGGGTGGAGG - Intergenic
1102547338 12:113666279-113666301 AAGCCGGAACAAGAGGGTGTGGG + Intergenic
1103137264 12:118518413-118518435 AAGCAGGAAGAAGGGGGTTGCGG + Intergenic
1103342740 12:120229811-120229833 AAGCAGGTAAATGTGGGGCATGG + Intronic
1103932415 12:124457739-124457761 AAACAGGAACATGTGGCGCAGGG + Intronic
1104178111 12:126352045-126352067 AAGGGGGAACCAGTGGGTCAGGG + Intergenic
1104906373 12:132215580-132215602 AAGCAGGATCAAGTGGACCCTGG - Intronic
1105606892 13:21933373-21933395 GAGCAGGAAGAAGTGGTTCAAGG - Intergenic
1106643743 13:31611345-31611367 GAGGAGGAACAGATGGGTCAAGG + Intergenic
1106694478 13:32157644-32157666 AAACATGGACTAGTGGGTCATGG - Intronic
1106861206 13:33910873-33910895 GAGCAGGAGGAAGTGGGGCAGGG + Intronic
1107226224 13:38050770-38050792 AAGCAGGAAGAAGAGAGTGAAGG - Intergenic
1108519555 13:51234206-51234228 ACTCAGGAACAAATGGGTAAAGG - Intronic
1108708999 13:53015208-53015230 AAGTGAGAACAGGTGGGTCAAGG - Intergenic
1110156106 13:72318722-72318744 AAGCTGGAACAAAAGAGTCAAGG + Intergenic
1113296848 13:108968720-108968742 AGGCAGGAGCAACTGGTTCATGG - Intronic
1114417596 14:22554776-22554798 GACCAGGAGCAAGTGGGTCGAGG + Intergenic
1117000961 14:51370801-51370823 AAGCAGGAGCAAGAGAGTGAAGG + Intergenic
1117089938 14:52239369-52239391 AAGTAGGAAGAAGAGGGTCAGGG + Intergenic
1117332407 14:54726209-54726231 AAGTAGGAAAGAGAGGGTCAGGG - Intronic
1119792562 14:77365756-77365778 TAGCAGGAAAAAGTGTGTGAAGG + Intronic
1119918803 14:78427066-78427088 AAGGAGGAGCAAAAGGGTCAAGG + Intronic
1120170007 14:81238624-81238646 AATTAGGAACAAGTGGGAGAGGG + Intergenic
1121325067 14:93015057-93015079 AGGCAGGAGCAAATGGCTCAGGG + Intronic
1121525923 14:94619250-94619272 GAGCAAGAAAAAGTGGGTAATGG + Exonic
1121782010 14:96627997-96628019 TAGCAGGAAGAAGTGGGTGAAGG + Intergenic
1122255414 14:100472540-100472562 TAGCAGGAACAAGGGCCTCATGG - Intronic
1122367074 14:101200633-101200655 CAGCAGGGAGAAGTGGGCCAGGG + Intergenic
1122443432 14:101750464-101750486 AAACAGAAACAAGTGGGTAATGG - Intergenic
1122889985 14:104727753-104727775 AAGGAGGAACTAGGGGGTGAAGG - Intronic
1124203002 15:27694380-27694402 GAGCAGGAACAAGTGAGAGAGGG - Intergenic
1125326095 15:38537395-38537417 AAGCAGGAGCAAGAGGGAGAGGG + Intronic
1126371097 15:47947740-47947762 AAGCAGGAGCATGTGGGTTCAGG - Intergenic
1127419441 15:58790810-58790832 AAGCAGGAAAAAATGGAGCAAGG + Intronic
1128522847 15:68386902-68386924 AAGCAGGGAGAGGTGGGACAGGG + Intronic
1128827095 15:70729442-70729464 AAGCAGGAACATGTGGGATTTGG - Intronic
1131581067 15:93644431-93644453 AGGCAGGAACACTTGGGTAAAGG - Intergenic
1131620395 15:94062108-94062130 GAGCAGGAAGAAGAGGGGCAGGG - Intergenic
1131860111 15:96644740-96644762 AAACAGGAACAAGTTGGGAATGG + Intergenic
1132651291 16:1022494-1022516 AAGCAGGAACCAGCGTGTCCTGG - Intergenic
1135243988 16:20838603-20838625 AAGTAGGGACAAGGGGCTCAGGG - Intronic
1138679106 16:58672248-58672270 GGGCAGGGACAACTGGGTCAGGG + Intronic
1138861361 16:60762194-60762216 AGGCAAGAAAAAGTGTGTCAGGG + Intergenic
1140195405 16:72850870-72850892 AAGCAGGAACATTTGACTCAAGG + Intronic
1140615826 16:76662043-76662065 AACAAGGAAAAAGTGGATCAGGG + Intergenic
1143115065 17:4577406-4577428 AAGCAGGGACAAGTTTGTCCTGG - Intergenic
1144374935 17:14629875-14629897 AGGAGGGAAAAAGTGGGTCATGG - Intergenic
1144498583 17:15766024-15766046 AAACAGGCAAGAGTGGGTCAAGG - Intergenic
1144947526 17:18977573-18977595 AAGGAGGCACAGGTGGGTCAGGG - Exonic
1145161966 17:20581064-20581086 AAACAGGCAAGAGTGGGTCAAGG - Intergenic
1146210405 17:30938045-30938067 AAGCAGGAAAAAGGTGTTCAAGG + Intronic
1147183283 17:38700300-38700322 AACTAGGACCAAGTGGGTGAGGG - Intergenic
1150307322 17:64096853-64096875 AAGCAGAATGAAGTGGCTCAGGG + Intronic
1151880830 17:76893534-76893556 AAGCAGGACCAAAGGGCTCAGGG + Intronic
1153153860 18:2127203-2127225 AGGCAGGAAAAAGGGGGTTAGGG - Intergenic
1153167029 18:2273822-2273844 AAGCAGGAGCAAGAGGGAGAAGG + Intergenic
1154272591 18:12932876-12932898 AAGCAGCAACAGTTGGGGCAGGG - Intergenic
1157901917 18:51526208-51526230 AATCATGCACAAGTGGCTCATGG + Intergenic
1159752199 18:72316261-72316283 AAGAAGGAAAAAGTGTGTAATGG - Intergenic
1159828021 18:73238950-73238972 AAACAGGAAGAATGGGGTCAAGG - Intronic
1161151324 19:2711559-2711581 AAGCAGGAACAGGTGAGGCCTGG - Intergenic
1161421086 19:4176207-4176229 AAACAGGAACAATTGGAGCATGG + Intronic
1161534723 19:4811957-4811979 AAGCAGGGCCTGGTGGGTCATGG - Intergenic
1163045316 19:14637262-14637284 AGGCTGGAAAATGTGGGTCAGGG - Intronic
1163542708 19:17920756-17920778 AGGCAGAAACAAGAGGGTAAGGG + Intergenic
1164538696 19:29106190-29106212 GAGGAGGACCAAGGGGGTCAGGG - Intergenic
1165109575 19:33493853-33493875 CAGGAGGTCCAAGTGGGTCATGG - Intronic
1166332802 19:42088454-42088476 AAGCAGGATGAAGTGGGTGGTGG + Intronic
1166893232 19:46007427-46007449 AGGCAGGAAGAAGAGGGACAGGG + Intronic
1167061260 19:47148242-47148264 AAGCAGGATGGAATGGGTCAAGG + Intronic
1167718547 19:51160986-51161008 GAACAGGCCCAAGTGGGTCATGG + Intergenic
1167720157 19:51173932-51173954 GAGCAGGCCCAAGTGGGTCATGG + Intergenic
1167906387 19:52664512-52664534 AAGAAGGAACCACTGGGTCCTGG + Intronic
925140866 2:1549193-1549215 AAGCAGGAACCAGGGGGTTCTGG - Intergenic
925539461 2:4951438-4951460 AAGCAGGAGCAAGAGAATCAGGG + Intergenic
925775194 2:7328381-7328403 AAGCAGGAGCAAGAGAGCCAGGG - Intergenic
926071668 2:9899160-9899182 AGGCTGGAACAAGTGGGGAATGG - Intronic
926146127 2:10398092-10398114 ATGCAGGAGCAGGTGGGGCAGGG - Intronic
926563762 2:14446351-14446373 AAGAAGGAGAAAGTGGGGCAAGG + Intergenic
926764523 2:16312628-16312650 AAGCAGGGGAAAGTGGGTCATGG + Intergenic
926822635 2:16869949-16869971 AAGCAGGAACAAATGGTTTGGGG - Intergenic
930331488 2:49990670-49990692 AAGCAGGAAGAAATGAGTGAAGG + Intronic
934621298 2:95810026-95810048 AAGCAGGAACAAGAGAGTGAGGG + Intergenic
934812145 2:97288788-97288810 AAGCAGGAACAAGAGAGTGAGGG - Intergenic
934825549 2:97419139-97419161 AAGCAGGAACAAGAGAGTGAGGG + Intergenic
935088151 2:99868478-99868500 AAGCAGGAGGAAGTTGCTCAGGG + Intronic
935276627 2:101480922-101480944 AAGCAGAAACAAGTCCCTCAGGG + Intergenic
936706062 2:115075045-115075067 AAGCAGTTATACGTGGGTCATGG + Intronic
939167348 2:138653913-138653935 AAGCAAGAGCAAGAGAGTCATGG + Intergenic
939359426 2:141149559-141149581 AAGCAGTCTCAAGTGGATCAAGG - Intronic
941869973 2:170373676-170373698 AAGCAAGAGGGAGTGGGTCAGGG + Intronic
943850903 2:192721536-192721558 GAGCAGGAGCAAGAGGGTGAGGG - Intergenic
944817789 2:203396837-203396859 TAGCAGGAACAAGAGGAGCAGGG - Exonic
945063801 2:205931408-205931430 AGGCAGAAGCAAGTGGCTCAAGG + Intergenic
945585704 2:211659867-211659889 AAACATGAAAAAGTGGTTCATGG + Intronic
946201113 2:218071295-218071317 AAGCAGGAAGATGTGTGTCGGGG - Intronic
946486147 2:220102755-220102777 AATCAGGATCAAGTGGTTCTTGG + Intergenic
946890814 2:224274310-224274332 AAGAAGGAACCAGTGGCTCATGG - Intergenic
947228725 2:227864319-227864341 GAGCAGGAATAAGTGAGTCGTGG + Intergenic
948668751 2:239552895-239552917 GAGCAGCAACAAGAGGGACACGG - Intergenic
1168960277 20:1864311-1864333 CAGCTGGGACAGGTGGGTCATGG + Intergenic
1169737978 20:8857855-8857877 AAGAAGGAACATGTGGCTAAAGG - Intronic
1170959193 20:21009996-21010018 AAGGAGGAATTAGCGGGTCAGGG + Intergenic
1173009360 20:39167790-39167812 AAGCAGAAGCCAGTGGGTTAGGG - Intergenic
1173067822 20:39729784-39729806 AAGCAGGAGCAAGTGGGGGGTGG - Intergenic
1173912235 20:46678951-46678973 AAGCAGGAACAAGAGAGAGAAGG - Intronic
1175073070 20:56350844-56350866 GAGAAGGATGAAGTGGGTCAAGG + Intergenic
1175182268 20:57157059-57157081 AAGCAGGGACAAGGAGGTCACGG + Intergenic
1175454528 20:59101812-59101834 ATGCAAGAACAAGTGGGTAATGG - Intergenic
1175713108 20:61236815-61236837 AAGCAGGAAGAAGAGGGTGGAGG - Intergenic
1175930405 20:62491270-62491292 CAGCAGGAGCAAGGGGGACAGGG - Intergenic
1176049501 20:63110228-63110250 AAGCAGGAACAAGAGGGGGTGGG + Intergenic
1176308700 21:5138076-5138098 CAAAAGGAACAAGTGGCTCAAGG + Intronic
1178968586 21:37148917-37148939 AAGTAGGATCACTTGGGTCAAGG - Intronic
1179054925 21:37922463-37922485 AAGGAGGAAGAACTGGTTCAAGG + Intergenic
1179102013 21:38362235-38362257 GAGCAGGTCCAAGTGGGACATGG + Intergenic
1179373724 21:40830249-40830271 AAGCAGGAACAAGAGAGACAGGG + Intronic
1179611253 21:42552789-42552811 AAGCAGGAAGAAGAGGGCCCGGG + Intronic
1179782081 21:43707780-43707802 AAGCAGGAGCAAGAGAGTGAGGG - Intergenic
1179848359 21:44123956-44123978 CAAAAGGAACAAGTGGCTCAAGG - Intronic
1180862553 22:19094135-19094157 AAGCATGAAAAGGTGGGGCACGG + Intronic
1181759897 22:25051095-25051117 AAGCAGGCAAGAGTGGGGCAGGG - Intronic
1184047924 22:41983306-41983328 AACCAGTAGCAAATGGGTCAGGG + Intronic
1184176522 22:42792392-42792414 AATGAGGAACCCGTGGGTCACGG - Intergenic
950364363 3:12472552-12472574 CAGCAGGAACAAGGGGCTCTAGG - Intergenic
951133224 3:19073660-19073682 AAGCAGGAGCAAGAGAGTGAGGG - Intergenic
951648477 3:24921043-24921065 AAGCAGGTAAAAGCAGGTCAAGG + Intergenic
952195094 3:31067169-31067191 AAGCAGCAACCTGTGAGTCAGGG + Intergenic
954490691 3:50901730-50901752 CAGCAAGAGCAAGAGGGTCAGGG - Intronic
954580243 3:51699341-51699363 ACCCAGGGACAAGTGAGTCAGGG + Intronic
954914395 3:54136472-54136494 AAGCAGGAAGAAGTGAGAGAAGG - Intronic
954973881 3:54675030-54675052 CAGCAGCAACAAGAGGGCCATGG + Intronic
956861493 3:73328357-73328379 GAGCAGGAACAAAAGAGTCAGGG + Intergenic
957609756 3:82451837-82451859 GAGCAGGAAGAAGTGGGTAGAGG - Intergenic
959095457 3:101950760-101950782 AGGCAGGAAGAAGTGGTTCAGGG - Intergenic
960022638 3:112972553-112972575 AAGGAGGAAGAAGTGGCACAGGG + Intronic
960620752 3:119634744-119634766 AAGCAAAAACAAAAGGGTCAAGG - Intergenic
961633497 3:128318444-128318466 GAGCAGGAACGGGTGGGACAGGG - Intronic
962217716 3:133537029-133537051 AAGAGGGAAGAAGTGGTTCAAGG + Intergenic
962743583 3:138381421-138381443 AAGCAGGAGGTAGTGGGACAGGG - Intronic
963852287 3:150221006-150221028 AAGAAGGAACAATGGGGGCAGGG + Intergenic
964080717 3:152752948-152752970 AATCAGGAACAAGGGAGACAGGG - Intergenic
965364060 3:167776934-167776956 AAACTGGACCAAGTAGGTCAAGG - Intronic
966531232 3:180983153-180983175 AAGCAGAAACAGGTCGATCAAGG + Intergenic
968136139 3:196220808-196220830 AAGCAGGAAGAAGTGCCTCTGGG + Intronic
969119922 4:4900660-4900682 AAGCAGGAGGAAGTGGGGGAGGG - Intergenic
970902470 4:21175720-21175742 AAGCAGGAAAGAGTGGGCCAGGG + Intronic
971321059 4:25606403-25606425 TAGGAAGAACGAGTGGGTCAGGG + Intergenic
971392285 4:26197439-26197461 AATCAGGAGAAAGTGGGCCAAGG + Intronic
973261484 4:48169150-48169172 AAGCAGAAAGAAGGGGGTCAAGG - Intronic
974744008 4:66046106-66046128 AAGGTGGAGCAAGGGGGTCACGG + Intergenic
975690104 4:76954521-76954543 CAGCAGGCATGAGTGGGTCAGGG - Intronic
976316715 4:83666556-83666578 GAGCAGGTAAAAGTGGTTCAGGG + Intergenic
978872305 4:113594118-113594140 AAGCAGGAACAAGAGAGAGAAGG + Intronic
980158610 4:129134431-129134453 AAACAGGCAAAAGTAGGTCAAGG - Intergenic
981310887 4:143297193-143297215 AAGAAGAAAAAAGTAGGTCAGGG + Intergenic
983195190 4:164798927-164798949 AAGCAGGAACAAGAGGGTGAGGG - Intergenic
984615914 4:181897096-181897118 AAGAAGGAACAATTGGGCTAGGG - Intergenic
986199552 5:5569129-5569151 AAGCAGGACCAATAGGGGCAGGG - Intergenic
987230511 5:15889076-15889098 AAGCAGAAAAAAGTGGGGCGGGG + Intronic
991012764 5:61901134-61901156 AAGCAGGAACAAGAGTGTGGTGG - Intergenic
991215764 5:64156117-64156139 AAGGAGGAATAAGGAGGTCAGGG + Intergenic
991623811 5:68576014-68576036 AAGTAGAAACAGGTGGGGCATGG - Intergenic
992858752 5:80891022-80891044 AAGCTGGAGCAAGTGGCTCAAGG + Intergenic
993909178 5:93660601-93660623 TAGCAGGAACAAGAGTGTGATGG + Intronic
994192273 5:96881754-96881776 AGGCAGGAAGAAGGGGGACACGG + Intronic
995915826 5:117243394-117243416 AAGCAGGAGCAAGAGAGTGAGGG - Intergenic
996004815 5:118406927-118406949 AGGCAGGAACAAGAGGAACAGGG + Intergenic
996508127 5:124290042-124290064 AAGAAGGAACATCTGGCTCAGGG - Intergenic
996762494 5:127000493-127000515 AAGGAGTAACAAGTGGGACCAGG + Intronic
998813681 5:145991457-145991479 AAGCAGGAAGCAGTGGAGCAAGG - Intronic
999361784 5:150991885-150991907 AAACAGGAAAGAGTGGGTGAAGG + Intergenic
999742542 5:154567291-154567313 GAGCAGGAGCAAGCGGGGCAAGG + Intergenic
1001483026 5:172101665-172101687 AAGAAGGAAGAAGTAGGGCAGGG + Intronic
1001508115 5:172296551-172296573 CAGCAGGAAAGAGGGGGTCAGGG + Intergenic
1001578880 5:172784750-172784772 AAGCAGGAACGAGAGAGACAGGG - Intergenic
1002044486 5:176534291-176534313 AGGCAGAAACAAGTGGGACCAGG - Intronic
1002690719 5:181048120-181048142 GAACAGGACCAAGTTGGTCAAGG + Exonic
1003168832 6:3704354-3704376 AAGCAGGAGCAAGAGAGTGAGGG - Intergenic
1004418247 6:15444935-15444957 AAGCAGGAGCAAGGGGGACCAGG - Intronic
1005285957 6:24327069-24327091 AACCATGAACAAGTCAGTCAGGG + Intronic
1006344119 6:33466258-33466280 CAGAAGGAAAAAGTGGTTCATGG + Intergenic
1006471274 6:34230363-34230385 AAGCATGATCAAGTGGATGAGGG + Intergenic
1007127476 6:39439677-39439699 AAGCATTAAGAAGTGGGTAAGGG - Intronic
1007442701 6:41877082-41877104 AAGCATGAACAAAAGGCTCAAGG + Intronic
1007757314 6:44108393-44108415 AGGCAGGTACACATGGGTCAGGG - Intergenic
1008000501 6:46355297-46355319 ATGCAGAAACAAGTGGCTCATGG + Intronic
1008322323 6:50131788-50131810 AAGAATGAACATGTGGGTCTTGG + Intergenic
1009550039 6:65078903-65078925 AAGCAGGAACAAGAGGGAGTGGG - Intronic
1010977371 6:82331084-82331106 AAGAGGGAAAAAGTGGTTCATGG - Intergenic
1011503447 6:88015508-88015530 AAGTAGGCACAAGTGGGCAAAGG - Intergenic
1013316857 6:108951607-108951629 AAGCAGGAACAAGTTGGTATTGG + Intronic
1013465796 6:110415885-110415907 AAGCAGGAAGGAGGGGGTGAGGG + Intergenic
1013899644 6:115139280-115139302 AAGAAGGATAAAGAGGGTCAGGG + Intergenic
1014893670 6:126873141-126873163 AAGCAAGAGCAAGTGAGTCGGGG - Intergenic
1015888948 6:137949811-137949833 AACCAAAAACAAGTGGCTCATGG + Intergenic
1015992893 6:138966287-138966309 AAGCAGGAGCAAATGGGACAGGG + Intronic
1016308076 6:142703973-142703995 AAGAAGGAACAGGTAGTTCAAGG + Intergenic
1018377516 6:163227262-163227284 AAGCAGGAACAAGAGGGAGGTGG + Intronic
1019045524 6:169142527-169142549 AAGCCCGAGCAAGTCGGTCATGG + Intergenic
1019073027 6:169365587-169365609 AATCAGGAAGAAGAGGGGCAGGG + Intergenic
1019558009 7:1642114-1642136 AGGCAGGAACAAGGGGGTGAGGG + Intergenic
1020544749 7:9512955-9512977 AAGCATGAATAAGTGGAGCATGG - Intergenic
1021229925 7:18073973-18073995 ATGCAAAAACATGTGGGTCATGG - Intergenic
1023610235 7:41965111-41965133 AACCAGGACCCAGTGGGACAGGG - Exonic
1024152208 7:46583435-46583457 AAGCAGGTACAAGGTTGTCATGG + Intergenic
1024275459 7:47673482-47673504 CAACAGGAACAGGTGGGTGATGG + Intergenic
1027513409 7:79110918-79110940 AAGCAGGAACAAGAGGGTATGGG - Intronic
1028741683 7:94282475-94282497 AATGAGGAGCATGTGGGTCAAGG - Intergenic
1028809054 7:95062759-95062781 AAGCAGAAAAAAGTGGGGCAGGG - Intronic
1029447083 7:100619756-100619778 AAGCAGAAACAAGCTGGGCACGG - Intergenic
1030132943 7:106218664-106218686 AAGCAGGAAAAAGAGAGTGAGGG - Intergenic
1031410660 7:121436993-121437015 TACCAGGAACATGTGGGGCAAGG + Intergenic
1031497457 7:122467932-122467954 AAGAAAGAAAAAGTGAGTCAAGG - Intronic
1034542069 7:151764699-151764721 TCCCAGGAGCAAGTGGGTCAGGG + Intronic
1034643751 7:152625930-152625952 AAGCAGGAACAAGGGGGTGGGGG + Intergenic
1038375674 8:27037807-27037829 GTGCAGGAATAAGTGAGTCAGGG + Intergenic
1040449353 8:47528566-47528588 AGGCAAGAACAGGTGGGTGAAGG + Intronic
1041549209 8:59080731-59080753 AAACAGGAACAAGAGGGTCGGGG - Intronic
1044112983 8:88299454-88299476 AATTAGGAAGAAGTGGGTGATGG - Intronic
1044244071 8:89920465-89920487 AAGCAGAAATAAGTAGGTCAAGG + Intronic
1044712914 8:95074064-95074086 ACGCAGGGAGAAGTGGGTAAGGG + Intronic
1044761345 8:95520866-95520888 AAGCAGGACCAAGAGGGTCGAGG + Intergenic
1045337698 8:101223754-101223776 AAGAAGGAAAAAGTAGGTTAAGG + Intergenic
1045481531 8:102596760-102596782 AAGCAGGACCAAAGGGGTCTTGG - Intergenic
1046121524 8:109853834-109853856 AGGAAGGAACAAGTGAGGCAGGG + Intergenic
1047653616 8:126951144-126951166 AAGCTGGAATAATTGAGTCAGGG - Intergenic
1048130564 8:131692939-131692961 AAGCAGGAGTAAGAGAGTCAGGG + Intergenic
1051374966 9:16393322-16393344 AGGCAGGGAGAAGAGGGTCAAGG + Intergenic
1052603466 9:30670412-30670434 AAGCTGGCAAAAGTAGGTCAGGG + Intergenic
1052722197 9:32185557-32185579 AAGCGGGAACAAGTGGGGTGGGG + Intergenic
1060280461 9:122212694-122212716 ATGCAGGGGCAAGCGGGTCATGG - Intronic
1187065506 X:15833338-15833360 AAGCAGTAAAAGGTGTGTCAGGG - Intronic
1187925812 X:24249318-24249340 AAGCTGGAACAATTTGGACAGGG - Intergenic
1188329763 X:28854680-28854702 GAGCAGGAACAATTGGGGCAGGG + Intronic
1188452113 X:30318288-30318310 AACCAGAAACATGTGGCTCAAGG - Intergenic
1189018111 X:37305503-37305525 AACCAGCAACAAGTGGGTGAAGG - Intergenic
1192038895 X:67596083-67596105 AAGCAGGAACAAGAGAGCAAGGG - Intronic
1193715991 X:84935155-84935177 AAGCAAGAACAAGGGGGTGGTGG + Intergenic
1194280076 X:91940165-91940187 AAGCAGGAGCAAGAGAGGCATGG - Intronic
1194922380 X:99781713-99781735 GAGCAGGAGCAAGTGGGTGGGGG + Intergenic
1196649152 X:118151135-118151157 AAACAGAAATAAGTGGGGCATGG - Intergenic
1196899205 X:120366663-120366685 AAGGAGGAGGAAGAGGGTCAAGG + Exonic
1197278447 X:124507174-124507196 GAGCAGGAATAAGTGGATAAGGG + Intronic
1197338397 X:125235650-125235672 GAGCAGGAACAAGAGAGCCAAGG - Intergenic
1198029727 X:132743307-132743329 AAACAGGAATGAGTGGGGCAGGG + Intronic
1198512601 X:137368449-137368471 TAGAAGGAGCAAGTAGGTCAAGG + Intergenic
1198543030 X:137660816-137660838 AAACAAATACAAGTGGGTCAGGG - Intergenic
1198992630 X:142532895-142532917 AAGCAGGAAAATGTAGGTAAGGG - Intergenic
1199074356 X:143512085-143512107 AACCAGGAAACAGTGGGTGAAGG - Intronic
1199093360 X:143715352-143715374 AACCAGGAAAGAGTGGGTGAAGG - Intronic
1199214975 X:145252814-145252836 AACCAGGAAAGAGTGGGTGAAGG + Intronic
1199608746 X:149596299-149596321 AAGCAGTAACAAGTGTGGCAAGG + Intergenic
1199630376 X:149773061-149773083 AAGCAGTAACAAGTGTGGCAAGG - Intergenic
1199728309 X:150606598-150606620 AAGGAGGAAAAAATGGGTGAAGG - Intronic
1199983513 X:152934198-152934220 ATGCAGGACCCAGTGGGCCATGG - Intronic
1200076234 X:153552616-153552638 AGGCAGGAGCATGTGGCTCATGG - Intronic
1200597551 Y:5163666-5163688 AAGCAGGAGCAAGAGAGGCATGG - Intronic
1200784225 Y:7245313-7245335 AGTCAGGAACATGTGGGGCATGG - Intergenic
1201918732 Y:19210749-19210771 AGTCAGGAACAGGTGGGACATGG - Intergenic