ID: 906088223

View in Genome Browser
Species Human (GRCh38)
Location 1:43154751-43154773
Sequence ACTATGAGGTTTTGCAGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 194}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906088212_906088223 30 Left 906088212 1:43154698-43154720 CCAGAAAGAAGACTTTTCCAAGT 0: 1
1: 0
2: 0
3: 24
4: 279
Right 906088223 1:43154751-43154773 ACTATGAGGTTTTGCAGTGAGGG 0: 1
1: 0
2: 2
3: 14
4: 194
906088216_906088223 13 Left 906088216 1:43154715-43154737 CCAAGTGGGGAAACTACTGTGAA 0: 1
1: 0
2: 1
3: 9
4: 134
Right 906088223 1:43154751-43154773 ACTATGAGGTTTTGCAGTGAGGG 0: 1
1: 0
2: 2
3: 14
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906088223 Original CRISPR ACTATGAGGTTTTGCAGTGA GGG Intronic
902721812 1:18309060-18309082 AGTATGGGGGTATGCAGTGAGGG - Intronic
904420935 1:30390954-30390976 ACAATGATGTTCTGCAGTTAGGG - Intergenic
904450427 1:30607427-30607449 ACTATGAGGTTTTAATGAGATGG - Intergenic
906088223 1:43154751-43154773 ACTATGAGGTTTTGCAGTGAGGG + Intronic
909034232 1:70579130-70579152 CCAATGAGGTTTTGCAGTGAGGG - Intergenic
909519055 1:76546308-76546330 ACTCAGAGGTTTTGGAGTGATGG + Intronic
910488603 1:87743439-87743461 ACTACGTGGTTTTGCGGTCAAGG + Intergenic
910667832 1:89743312-89743334 AATATGAGGTTATTCAGAGAAGG + Intronic
912760031 1:112358760-112358782 GCGCTGAGGTTGTGCAGTGAAGG + Intergenic
913475537 1:119233384-119233406 ACTGTGAGGTGTTTCAGTCAAGG - Intergenic
915088603 1:153405797-153405819 ACTGTTAGGTTTTGAAGGGAAGG - Intergenic
915096292 1:153465035-153465057 ACTGTTAGGTTTTGAAGGGAAGG + Intergenic
915547197 1:156607042-156607064 ACAATGGGATTTTGCAGTGGGGG - Intergenic
920562279 1:206947301-206947323 TCTGTGGGGGTTTGCAGTGAGGG - Intergenic
922242378 1:223764217-223764239 AGGATGAGGTTTTGCAATGAGGG - Intronic
923705106 1:236337594-236337616 ACAATGGGGTTTTGTAGTAAGGG + Intergenic
924897215 1:248353285-248353307 ACTATGATAATTTGCACTGATGG - Intergenic
1063698777 10:8364423-8364445 TCTATGAAGTTAAGCAGTGAGGG + Intergenic
1064597097 10:16956505-16956527 AGTAAGAGGTTTTGTAGTGATGG - Intronic
1066949952 10:42107650-42107672 ACAATGGGGCTTTGCAATGAGGG - Intergenic
1068348980 10:55819576-55819598 AGTATGAAGTTTTCTAGTGATGG - Intergenic
1069722553 10:70559155-70559177 GGTATGAGGGCTTGCAGTGAGGG + Intronic
1071441315 10:85699237-85699259 ACTATGGGGTTTTGCAATGTTGG + Intronic
1074295636 10:112185055-112185077 ATTATGAGGTTTTCCAGTCGGGG - Intronic
1077649278 11:3955221-3955243 AGAATGAGGGTTGGCAGTGAAGG + Intronic
1079619038 11:22530591-22530613 ACTATAATGTTCTACAGTGAAGG - Intergenic
1080399697 11:31922402-31922424 GCTATGAGGTCTACCAGTGAAGG - Intronic
1081285931 11:41270227-41270249 AGAGTGAGGTTTTGCACTGAAGG - Intronic
1082960759 11:58916656-58916678 CCTCTGAGGTTTGGAAGTGAGGG + Intronic
1085202640 11:74710981-74711003 AGTGTGAGGTTCTGCAGTGGGGG + Exonic
1087359911 11:97145082-97145104 TTTATCAGGTTTTGCAGTCAGGG - Intergenic
1088415597 11:109585685-109585707 ACTGTGAAGTTTAGCAATGAGGG + Intergenic
1088607581 11:111546246-111546268 ACTAGGAGGTTTTGGATAGAGGG - Intronic
1088781239 11:113136241-113136263 ACTTGCATGTTTTGCAGTGATGG - Intronic
1093114162 12:15189005-15189027 ACTACGATGTTGTGTAGTGATGG + Intronic
1093381237 12:18496367-18496389 TCTCTTAGGTTTTGCACTGAAGG - Intronic
1093501784 12:19821428-19821450 ACTTTGAAGTTTGGTAGTGATGG + Intergenic
1095196822 12:39328941-39328963 ATTATGATATATTGCAGTGAAGG - Intronic
1097907747 12:64937987-64938009 AATAAGAGGTTATGCTGTGATGG + Intergenic
1098092314 12:66916613-66916635 AATATGAGATTTTGAAGTAATGG - Intergenic
1099901765 12:88719371-88719393 TCTATAAGGATTTGCAGAGAGGG - Intergenic
1101880249 12:108621485-108621507 GCTATGGGATTTTGCAGTGGGGG - Intergenic
1103212649 12:119178297-119178319 GCAATGGGATTTTGCAGTGAGGG - Intergenic
1103346927 12:120257401-120257423 ACTATGAGGTCTTCTAGCGAGGG - Intronic
1105927566 13:25020981-25021003 ACTGTGAGGCTGTGCTGTGAAGG + Intergenic
1106772927 13:32979738-32979760 ACTATGAGCTTGTGGATTGAGGG + Intergenic
1106882503 13:34147429-34147451 ACTCTGAGGGTCTGAAGTGAGGG - Intergenic
1107093962 13:36514951-36514973 GCACTGAGGTTTGGCAGTGAAGG + Intergenic
1107434286 13:40368330-40368352 ACAATCATGCTTTGCAGTGAGGG - Intergenic
1111647265 13:91046732-91046754 GCAATGGGGTTTTGCAGTAAAGG - Intergenic
1113351585 13:109534797-109534819 AATATAAGGTTTAGCTGTGATGG - Intergenic
1114593289 14:23889845-23889867 ATACTGAGGTTTTCCAGTGAAGG + Intergenic
1117773729 14:59160947-59160969 ACTGTTTGGTTTTGCAGTGCAGG + Intergenic
1118759780 14:68873207-68873229 ACTATGAGCTGGTCCAGTGATGG + Intergenic
1121539148 14:94711968-94711990 ACCGTGAGCTTTTCCAGTGAGGG - Intergenic
1121702873 14:95969109-95969131 ACTCCTAGGTTTTGCTGTGATGG + Intergenic
1122749723 14:103923867-103923889 ATTATTAGGTTTTGAAGGGAAGG + Intronic
1128676904 15:69616324-69616346 AGTAGGAGGTTCTGCAATGATGG - Intergenic
1130029784 15:80301811-80301833 ACTATGGGGTTTTGTAGATATGG + Intergenic
1130073653 15:80670507-80670529 ACTTTGTGGTTTTGCAGGCAGGG - Intergenic
1131162201 15:90113851-90113873 CCAAAGAGGTTTTGCAGTTATGG - Intergenic
1132602118 16:778079-778101 ACTGTGTGGTTTTCCCGTGAAGG + Intronic
1136035525 16:27536854-27536876 GGCATGAGGTTGTGCAGTGAGGG + Intronic
1139040009 16:62988286-62988308 ATTATGATGTTTTGCCCTGAAGG + Intergenic
1140755479 16:78062777-78062799 GCAATGGGGTTTTGCAATGAAGG + Intronic
1141606366 16:85156084-85156106 AAGATGAGGTTTTACCGTGATGG - Intergenic
1141826254 16:86482428-86482450 AATATGAGGTTTTCCTGGGATGG + Intergenic
1143006809 17:3842061-3842083 TCTATGAGGTGTTACAATGAAGG + Intronic
1149640825 17:58201380-58201402 TCTATTAGGTTTTGAAGGGAAGG + Intronic
1153134913 18:1905726-1905748 GCAATGGGATTTTGCAGTGAGGG + Intergenic
1153909762 18:9696534-9696556 ACTGTCAGGTTTTGAAGGGAAGG - Intergenic
1158316231 18:56213973-56213995 AATATGAGGTTTGGGAGAGAGGG - Intergenic
1158383778 18:56966105-56966127 ACAACGGGGTCTTGCAGTGAGGG + Intronic
1158520286 18:58166736-58166758 ACTGTGAGGTTTAACAATGAAGG + Intronic
1163793827 19:19324123-19324145 AGTAAGAGGTTAGGCAGTGATGG + Intronic
1164960866 19:32428395-32428417 GCAATGAGGTCTTGCAGTGGTGG + Intronic
1168558357 19:57362442-57362464 ACTGTTAGGTTTTGAAGGGAAGG - Intergenic
926414601 2:12636762-12636784 AATATGAGGTTATTCAGTTAAGG - Intergenic
926456562 2:13074328-13074350 CCTGTGAGGTTATGAAGTGAGGG + Intergenic
926634961 2:15169157-15169179 ACACTGAGGGTTTGCAGAGAGGG - Intronic
930383517 2:50661942-50661964 AATAGGAGGAATTGCAGTGATGG - Intronic
931182403 2:59915953-59915975 ACTATGAGGCTTTGAAGACAAGG - Intergenic
932047277 2:68362414-68362436 AATATGAGGTTTCTGAGTGAGGG + Intergenic
932286735 2:70540205-70540227 ATTATGAGGGTTAGAAGTGATGG + Intronic
932986838 2:76736461-76736483 ACAATGGGATTTTGCAGTGGGGG - Intergenic
934884849 2:98015293-98015315 ATCATTAGGTTTTGCAGTGTGGG + Intergenic
935628010 2:105187021-105187043 ACAATGGCGTTTTGCAGTGGGGG + Intergenic
937328471 2:121006644-121006666 ACAATGAGGTTTTGGAGGAAGGG + Intergenic
937423566 2:121778475-121778497 AGTGTTAGGTTTTGCAGGGAAGG - Intergenic
939569459 2:143823474-143823496 ACTAGTAGGTTTTTCAGTCATGG + Intergenic
942492179 2:176500370-176500392 AATATGTGGTTTGACAGTGAGGG + Intergenic
942817229 2:180066032-180066054 ACAATGATTATTTGCAGTGATGG - Intergenic
947251418 2:228109327-228109349 AATATGGGGTTTTTCATTGATGG + Intronic
947270226 2:228326562-228326584 ACTTTCAGGTTCTCCAGTGAGGG - Intergenic
947551791 2:231051811-231051833 ACTGAAAGGTTTTGCAGTTATGG + Intergenic
1170187212 20:13604144-13604166 GCTATGGGATTTTGCAGTGAGGG - Intronic
1170431224 20:16278697-16278719 ACTATGAGCTTTTAAAGTGGAGG + Intronic
1170881931 20:20304605-20304627 ACTGTGAGGTTTTGGAGAGGCGG - Intronic
1171328069 20:24313418-24313440 GCTCCCAGGTTTTGCAGTGAGGG - Intergenic
1173873074 20:46353747-46353769 CAGATGAGGTTTTGCAGAGATGG + Intronic
1174000694 20:47372377-47372399 GCGATGAGGTTTTGCCATGAAGG - Intergenic
1177865242 21:26505170-26505192 ACTATGAAGTTTAGCAAAGAGGG - Intronic
1178226412 21:30724591-30724613 TCTAAAAGGTTTTGCTGTGAAGG + Intergenic
1183278555 22:36918537-36918559 ACGATGAGGTTTTGTAGTAGGGG - Intronic
1184093415 22:42304081-42304103 CCTTTGAGGTTTGGCGGTGATGG + Intronic
1185188097 22:49415140-49415162 ACTATGAGGATTTCCAGCCAAGG - Intronic
949289358 3:2445863-2445885 AATTTGAGGTTTTGCAGAGATGG + Intronic
951982722 3:28583334-28583356 AATAAGAGGTATTGCAGAGAGGG + Intergenic
953838917 3:46372726-46372748 GCAATGAAGTTTTGTAGTGAAGG - Intronic
956703412 3:71978997-71979019 ACGATGGGGTTTTGCAGTAGGGG + Intergenic
957548367 3:81670227-81670249 ACCATGTGGTTTTGCATTCAAGG - Intronic
961919287 3:130409066-130409088 AATAGGAGTTTCTGCAGTGATGG - Intronic
963060488 3:141221112-141221134 GCAATGGGGTTTTGCAGTGGGGG - Intergenic
964303230 3:155312027-155312049 CCTATGTGGGTTGGCAGTGAGGG + Intergenic
965589909 3:170352455-170352477 ACTATGTCATATTGCAGTGAAGG + Intergenic
967312795 3:188121927-188121949 AGTATGAGGTTCTCCAGTGCAGG + Intergenic
967953334 3:194857717-194857739 ATAATTAGGTTTGGCAGTGAGGG - Intergenic
970153986 4:13122570-13122592 ACTATGATGGTTTGCTATGATGG + Intergenic
972305165 4:37823856-37823878 CCTCTCAGGTTTTGCAGTCAGGG + Intergenic
975070919 4:70136578-70136600 TCTTTTAGGTTTTGGAGTGAGGG - Intronic
976158319 4:82171943-82171965 GCAATGGGGTTTTGCAGTGAAGG + Intergenic
976753011 4:88469334-88469356 AATATGAGATTTTGTAGTCAGGG + Intronic
977733114 4:100379373-100379395 ACTTTCAGTTTCTGCAGTGAGGG - Intergenic
978024343 4:103853345-103853367 ACCATGAGATTTTGCAGAGCAGG - Intergenic
981343677 4:143650937-143650959 ACTATGAATTTTTTCAATGATGG + Intronic
982326403 4:154133668-154133690 ACTGTGAGGTGCTTCAGTGATGG - Intergenic
982549528 4:156780362-156780384 TCTTTCATGTTTTGCAGTGAAGG - Intronic
982960416 4:161828222-161828244 ACCTTCAGGTTCTGCAGTGAGGG + Intronic
984471096 4:180175275-180175297 ACAGTGAAGTTTTCCAGTGAGGG - Intergenic
985440842 4:189981525-189981547 GCTCTGAGGTTTTGGAGTGGGGG + Intergenic
987400776 5:17474049-17474071 ACTATGAGGTTTTCTAGATATGG - Intergenic
989120709 5:38002005-38002027 ACTCTGAGCTTTTACTGTGAGGG + Intergenic
989453506 5:41614771-41614793 TCTAAAAAGTTTTGCAGTGAAGG - Intergenic
992262375 5:74984416-74984438 GCAATGAGGTTTTGGAGTGGGGG + Intergenic
993327523 5:86560476-86560498 AGTTTCAGGTTCTGCAGTGAGGG - Intergenic
993953324 5:94201782-94201804 TCAATGGGGTCTTGCAGTGAAGG + Intronic
995419567 5:111948772-111948794 ACTATGAGTCTTTCCAGTGTGGG + Intronic
996221841 5:120942447-120942469 ACTTTGAGTTTTGGCAGTGGAGG - Intergenic
996533533 5:124551630-124551652 AAGATGAGGTTTTGCCGTGTTGG + Intergenic
998456205 5:142275481-142275503 GCAATGGGGTCTTGCAGTGAGGG - Intergenic
998646387 5:144066798-144066820 GCAATGAGATTTTGTAGTGAGGG + Intergenic
1000662237 5:163950964-163950986 TCTGTGAGGTGTTTCAGTGATGG + Intergenic
1001231715 5:169994424-169994446 ACTATGAGCTTCTGCAGGGCAGG - Intronic
1004450764 6:15743591-15743613 ATCATGGGGTTTTGCAGTGGGGG - Intergenic
1005131005 6:22507972-22507994 CCTATGAGGATTTGAAGGGAGGG + Intergenic
1005762316 6:28978431-28978453 GCAAGGAGGTTTTGCAGTGAGGG - Intergenic
1006204895 6:32331874-32331896 ACTGTTAGGTTTTGGAGGGAAGG - Intronic
1007245837 6:40461818-40461840 AGTGTGAGGTTTTGCGGGGAGGG - Intronic
1008332075 6:50257401-50257423 ACTATGAGGTTTTTTAGATATGG + Intergenic
1011287356 6:85739125-85739147 CCAATGGGGTCTTGCAGTGAGGG + Intergenic
1012914866 6:105158725-105158747 ACAATCAGTTTCTGCAGTGAGGG + Exonic
1012936583 6:105374135-105374157 AGCCTGAGGGTTTGCAGTGAAGG + Intronic
1013250651 6:108329760-108329782 GCTATTAGGTTTTCCAGTGATGG + Intronic
1015189914 6:130461143-130461165 AGTAGGAGGTTTTGCAGAAATGG - Intergenic
1016009516 6:139124795-139124817 ACGATGAGAATTTGCAGTTAGGG - Intergenic
1016845068 6:148561586-148561608 ACTATGAGTATCTTCAGTGAAGG + Intergenic
1019283747 7:213633-213655 TGTATGAGGTTTTGCAGGGCAGG + Intronic
1020358674 7:7304055-7304077 ACTTTCAGGTTTCCCAGTGAGGG + Intergenic
1020899836 7:13990648-13990670 ACTAGGACGTTAAGCAGTGAGGG + Intronic
1021404822 7:20252872-20252894 ACTCTGAGCTTTTGGTGTGATGG - Intergenic
1024682259 7:51704695-51704717 ACTATGAGGTTATGCTATTATGG - Intergenic
1025006865 7:55362386-55362408 ACGATGGGATTTTGCAGTGTGGG + Intergenic
1027822402 7:83063600-83063622 ACTATGATGTTTAGCAGTTTAGG + Intronic
1029526095 7:101094877-101094899 ACTATGAGGTATCACAGTGCTGG - Intergenic
1029662907 7:101975059-101975081 ACGATGAGGTTTTGCCATGTTGG - Intronic
1031284781 7:119853251-119853273 ACTATGAAGCTTTTGAGTGATGG - Intergenic
1032566890 7:132955711-132955733 GCAATGAGGTCTTGGAGTGAGGG + Intronic
1032895451 7:136246006-136246028 CTTAAGAGGTTTTGCAGTAAGGG + Intergenic
1035243231 7:157545738-157545760 ACGATGATGTTTTGCTGTCAGGG + Intronic
1036956407 8:13192527-13192549 AGTGTGAGGATTTGCAGTGCTGG - Intronic
1039184734 8:34904578-34904600 TCTAGGAGGATTTGCAGTGAGGG - Intergenic
1039811648 8:41054402-41054424 ACAATGTGGTCTTGCAGTGAGGG - Intergenic
1040443886 8:47473673-47473695 ACTATGAGCTTCTGGAGTGCAGG + Intronic
1041473930 8:58241535-58241557 ACTATGAAGTTATTCTGTGAGGG - Intergenic
1041652746 8:60317127-60317149 GCGATGGGGTATTGCAGTGAAGG - Intergenic
1042182982 8:66110672-66110694 ACTATCAGGCTTTGCATTTATGG + Intergenic
1042205743 8:66327951-66327973 TCTATTAGGTTTTGAAGGGAAGG - Intergenic
1042398965 8:68323701-68323723 GCTATGGGGTTTTGCAGTAAGGG - Intronic
1043660848 8:82738475-82738497 ATTATGCAGTTTTGCAGAGATGG - Intergenic
1044818149 8:96133924-96133946 ACTTTGAGGTTTTACATTCATGG - Intergenic
1050424499 9:5499860-5499882 ACTGTTAGGTTTTGAAGGGAAGG + Intergenic
1050877500 9:10657074-10657096 AGTATGAAGATTTGAAGTGATGG + Intergenic
1051532049 9:18115139-18115161 TCTATGATGTTTTGAATTGATGG - Intergenic
1052084377 9:24246759-24246781 ATTATGAAGTTTCCCAGTGAGGG + Intergenic
1052206326 9:25845423-25845445 ACTCTGAGGTTTTCCTGTAATGG + Intergenic
1053185333 9:36011654-36011676 GCCATGGGATTTTGCAGTGAGGG + Intergenic
1054348719 9:63997073-63997095 AATATGAGGGTTTGGTGTGAAGG - Intergenic
1055257295 9:74386509-74386531 ACTTTTAGGTTTTGGAGGGAAGG - Intergenic
1057723175 9:97548999-97549021 ACTATCAGGTCTTGCGGTGTGGG - Intronic
1058730373 9:107844252-107844274 ACTATGTGGGTTTTCACTGAAGG + Intergenic
1060013492 9:120065559-120065581 GCAATGGGATTTTGCAGTGAAGG + Intergenic
1060915495 9:127387102-127387124 AGTTGGAGGGTTTGCAGTGATGG + Intronic
1062720772 9:138042796-138042818 ACTTTGAGGTCCTGCAGAGAAGG - Intronic
1186244389 X:7605436-7605458 AGTATGGGGTCTTGCAGTGAGGG - Intergenic
1186577440 X:10781185-10781207 AATATGTGGGTTTTCAGTGATGG + Intronic
1188209633 X:27406777-27406799 TCTCAGAGGTTCTGCAGTGAGGG - Intergenic
1188259348 X:28004084-28004106 TCTATGAGGATTTCCAGGGAGGG + Intergenic
1190163774 X:48054632-48054654 ACTATGAGTTTTTACACTGTGGG + Intronic
1190677829 X:52797246-52797268 ATTGTTAGGTTTTGAAGTGAAGG - Intronic
1190952829 X:55162727-55162749 GCTATGGGGTTTTGCAGTGAAGG - Intronic
1192614199 X:72601324-72601346 GCAATGAGGTCTTGCAGTAAGGG + Intronic
1192756715 X:74054063-74054085 ACTATGGGGTTTTGCAGGTATGG - Intergenic
1194912705 X:99666628-99666650 ACTATTGGGTTTTGTAGTTAGGG + Intergenic
1195024971 X:100867510-100867532 TCTATGCAGTTATGCAGTGATGG + Intronic
1197859557 X:130956120-130956142 ATTGTGAGGTTTTGTAGTGGAGG - Intergenic
1198219221 X:134584448-134584470 ACTATCAGATTTTGACGTGAAGG + Intronic
1198877446 X:141242358-141242380 ACTGTTAGGTTTTGAATTGAAGG - Intronic
1198908129 X:141584579-141584601 ACTGTTAGGTTCTGAAGTGAAGG - Intronic
1198908662 X:141589845-141589867 ACTGTTAGGTTCTGAAGTGAAGG + Intronic
1198918408 X:141698306-141698328 ACTGTTAGGTTCTGAAGTGAAGG - Intronic
1199044530 X:143153601-143153623 ACTCTGAGGTGTTGCAGTTGTGG + Intergenic