ID: 906088343

View in Genome Browser
Species Human (GRCh38)
Location 1:43155732-43155754
Sequence CAGTCTCAGTACTGGGACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 155}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906088333_906088343 16 Left 906088333 1:43155693-43155715 CCCCTGGCAGAGCCTCACCTTGG 0: 1
1: 1
2: 0
3: 29
4: 248
Right 906088343 1:43155732-43155754 CAGTCTCAGTACTGGGACACTGG 0: 1
1: 0
2: 2
3: 7
4: 155
906088332_906088343 17 Left 906088332 1:43155692-43155714 CCCCCTGGCAGAGCCTCACCTTG 0: 1
1: 0
2: 0
3: 27
4: 286
Right 906088343 1:43155732-43155754 CAGTCTCAGTACTGGGACACTGG 0: 1
1: 0
2: 2
3: 7
4: 155
906088331_906088343 21 Left 906088331 1:43155688-43155710 CCTGCCCCCTGGCAGAGCCTCAC 0: 1
1: 0
2: 5
3: 34
4: 415
Right 906088343 1:43155732-43155754 CAGTCTCAGTACTGGGACACTGG 0: 1
1: 0
2: 2
3: 7
4: 155
906088338_906088343 -1 Left 906088338 1:43155710-43155732 CCTTGGATAGACAAGATACCTCC 0: 1
1: 0
2: 0
3: 8
4: 91
Right 906088343 1:43155732-43155754 CAGTCTCAGTACTGGGACACTGG 0: 1
1: 0
2: 2
3: 7
4: 155
906088330_906088343 22 Left 906088330 1:43155687-43155709 CCCTGCCCCCTGGCAGAGCCTCA 0: 1
1: 0
2: 5
3: 45
4: 473
Right 906088343 1:43155732-43155754 CAGTCTCAGTACTGGGACACTGG 0: 1
1: 0
2: 2
3: 7
4: 155
906088335_906088343 15 Left 906088335 1:43155694-43155716 CCCTGGCAGAGCCTCACCTTGGA 0: 1
1: 1
2: 1
3: 20
4: 213
Right 906088343 1:43155732-43155754 CAGTCTCAGTACTGGGACACTGG 0: 1
1: 0
2: 2
3: 7
4: 155
906088337_906088343 4 Left 906088337 1:43155705-43155727 CCTCACCTTGGATAGACAAGATA 0: 1
1: 0
2: 8
3: 13
4: 98
Right 906088343 1:43155732-43155754 CAGTCTCAGTACTGGGACACTGG 0: 1
1: 0
2: 2
3: 7
4: 155
906088336_906088343 14 Left 906088336 1:43155695-43155717 CCTGGCAGAGCCTCACCTTGGAT 0: 1
1: 0
2: 2
3: 17
4: 179
Right 906088343 1:43155732-43155754 CAGTCTCAGTACTGGGACACTGG 0: 1
1: 0
2: 2
3: 7
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906088343 Original CRISPR CAGTCTCAGTACTGGGACAC TGG Intronic
900409571 1:2506615-2506637 GAGTCTCAGCTCTGGGACAGGGG + Intergenic
901014358 1:6219444-6219466 CAGGCACAAGACTGGGACACTGG + Exonic
901248537 1:7753862-7753884 CAGTGTCAGTACTCTGAAACAGG + Intronic
903806044 1:26006243-26006265 CAGTCTGAGTTCTGGGAACCAGG + Intergenic
906088343 1:43155732-43155754 CAGTCTCAGTACTGGGACACTGG + Intronic
912435004 1:109655686-109655708 CAGTCTCAGAGCTGGGGAACTGG + Intergenic
913329769 1:117657514-117657536 CAGTCTCCATACTGGGAGATGGG + Intergenic
915885007 1:159713041-159713063 CAGTCTCAGAATCAGGACACTGG - Exonic
918385612 1:184004745-184004767 CAGTCTCACTACAGAGCCACAGG + Intronic
918566024 1:185933086-185933108 CAGTCTCATTAATGAAACACAGG - Intronic
922594968 1:226806575-226806597 CAGCCTCTGGACTGGGAAACTGG - Intergenic
1063553005 10:7051160-7051182 AAGTCTCAGTACTCGTATACAGG + Intergenic
1067251100 10:44587698-44587720 CCCTCTCAGGACTGGCACACTGG + Intergenic
1067806017 10:49394494-49394516 CAGTCTCAGCACTGGGGTATTGG - Intronic
1073256251 10:102153263-102153285 CAATCTCAGTGCTGGTACAGAGG + Intronic
1074561198 10:114536736-114536758 CAGGGTCAGTATTGAGACACTGG - Intronic
1075360451 10:121827561-121827583 CAGTATCAGTTCGGGGACTCAGG - Intronic
1075621678 10:123932866-123932888 CAGTCTCAGTGCAAGGGCACAGG + Intronic
1076055940 10:127372949-127372971 CCATCTGAGTACTGGGACTCCGG - Intronic
1077797307 11:5505993-5506015 GAGACTCAGTACTGGGAGAGAGG - Intronic
1087174907 11:95087941-95087963 CAGTCCCTGTAGTGGCACACTGG + Intergenic
1087956858 11:104299239-104299261 CAGTCTCAGCAAAGGAACACAGG - Intergenic
1090394047 11:126407427-126407449 CAGGCTCAGAACTTGGGCACTGG - Intronic
1091463501 12:663862-663884 CAGTCTCAATACTGAGGCAGAGG + Intergenic
1094657979 12:32439471-32439493 CAATCTCACTACTGGGTAACTGG - Intronic
1095227601 12:39695622-39695644 CTGTCTCAGAACTGGGAGTCAGG - Intronic
1095864277 12:46954565-46954587 CAGTGTCAGGACTGGACCACTGG + Intergenic
1096478906 12:51924933-51924955 CAGTCCCAGCCCTGGGAGACTGG - Intergenic
1097791183 12:63817365-63817387 CATTATCAGTAATGGGATACGGG + Intergenic
1099276310 12:80580814-80580836 CAGGCACAGTGATGGGACACTGG - Intronic
1102903932 12:116660470-116660492 CAGCCTTAGTGCTGGGAGACTGG - Intergenic
1102914641 12:116743757-116743779 CAGTCCCAGTGCTGGGACCGGGG - Intronic
1104228362 12:126859288-126859310 CAGTGTCAGAACTGGGACACAGG - Intergenic
1104791660 12:131486308-131486330 CTGTCTCATTACTAGGACCCTGG + Intergenic
1109908956 13:68885360-68885382 CAGTCACAGCAGTGTGACACTGG + Intergenic
1122115972 14:99527436-99527458 CAGTCTCAGGACGGGGAGAAGGG + Intronic
1124506536 15:30281366-30281388 CAGTATCAAAAGTGGGACACTGG - Intergenic
1124737021 15:32257270-32257292 CAGTATCAAAAGTGGGACACTGG + Intergenic
1127097982 15:55533107-55533129 AAGTCCCACTACTGAGACACAGG - Intergenic
1127703865 15:61528099-61528121 CAGTCTCAGGACCAGGACCCGGG + Intergenic
1132328348 15:100991167-100991189 GATTCTCAGTACTGGTTCACTGG + Intronic
1134179678 16:12037385-12037407 CAGTCTCAGCCCTGGACCACAGG - Intronic
1135306423 16:21371154-21371176 CAGTCTCAGCCCTGGACCACAGG - Intergenic
1136303166 16:29350298-29350320 CAGTCTCAGCCCTGGACCACAGG - Intergenic
1136390886 16:29963438-29963460 CTGTCCCATTCCTGGGACACAGG - Exonic
1141571090 16:84934045-84934067 CAGAGTCAGCACTGGGATACCGG - Intergenic
1144403750 17:14932739-14932761 CAGCCTCTGGGCTGGGACACAGG + Intergenic
1147121677 17:38338789-38338811 CAAACCCAGTACTGGGAAACTGG - Intronic
1147152196 17:38523869-38523891 CAGAGTCAGTTCTTGGACACTGG + Intergenic
1149648140 17:58255232-58255254 CAGTCCCAGTAATGGCACCCAGG - Intronic
1150477445 17:65485940-65485962 CAGGCACAGTACTTGGTCACTGG + Intergenic
1150602032 17:66659456-66659478 CTCTCAAAGTACTGGGACACAGG - Intronic
1151265063 17:72948487-72948509 CAGTCTCAGTACAGGAACCACGG + Intronic
1152227950 17:79101447-79101469 CAGCCCCAGGGCTGGGACACTGG + Intronic
1156895510 18:42241044-42241066 CAGTCTCAGAGCTTGGAAACAGG + Intergenic
1157202043 18:45667841-45667863 CAGTCAAAGAACTGGAACACTGG - Exonic
1157940734 18:51926438-51926460 CAGTCACAGTACTGGGCCATGGG - Intergenic
1159838839 18:73372842-73372864 CAGAGTCCCTACTGGGACACTGG + Intergenic
1160579947 18:79877971-79877993 CAGTCTCAGGACGTGGCCACAGG - Intronic
1160968549 19:1757361-1757383 CAGTCTCAGCTCTGGGAGTCTGG + Intronic
1161167848 19:2797950-2797972 CCGTCTCAGTACTCGGGGACTGG + Intronic
1161570777 19:5029891-5029913 CACTCTCAGCACAGGGACTCAGG - Intronic
1161653540 19:5499189-5499211 CACTCTCACTGCTGGGCCACTGG - Intergenic
1166700517 19:44879207-44879229 CAGCCTCTGTCCTGGGACCCAGG - Intronic
1168626869 19:57925541-57925563 CTGTCTCAGTACTGGTCCAGAGG - Intronic
1202647878 1_KI270706v1_random:158078-158100 CAGTCCCTGCACTGGGACCCAGG + Intergenic
925521105 2:4746832-4746854 AAGTCACAGTGCTGGGATACTGG + Intergenic
929262949 2:39886388-39886410 GAGACTCAATTCTGGGACACTGG + Intergenic
932400420 2:71477043-71477065 CACTTTCAGTACTGGGAAGCTGG - Intronic
933407073 2:81874200-81874222 CTATATCAGTACTGGGAAACTGG - Intergenic
934898189 2:98136713-98136735 CACTCTCAATACTGTGACATTGG + Intronic
936345378 2:111671709-111671731 CACTCTCAGTTCAGGGCCACTGG + Intergenic
940235898 2:151510373-151510395 CAGCCTTTGTACAGGGACACTGG + Intronic
940330757 2:152471916-152471938 CAGTTTCAGTAGTGCGACTCCGG + Intronic
945688333 2:213000563-213000585 CAGTTTTACTACAGGGACACAGG + Intronic
1171865979 20:30488011-30488033 CAATCTCACAACTGGGACGCGGG - Intergenic
1173906323 20:46632265-46632287 CAGGCTCAGTCCTGGGCAACGGG - Intronic
1175996069 20:62812881-62812903 CAGCCTCAGGACGGGGACCCAGG + Exonic
1176603973 21:8814651-8814673 CAGTCCCTGCACTGGGACCCAGG - Intergenic
1178052305 21:28761528-28761550 CAGTCTGAGTTATGTGACACAGG - Intergenic
1178518027 21:33265038-33265060 CAGTTTAAGGACTGGGACTCAGG + Intronic
1179117491 21:38507443-38507465 CAGTGTCAGCACTGGGGCTCCGG - Intronic
1179493545 21:41756979-41757001 CAGCCTCAGGACTGAGACTCTGG - Intronic
1180346257 22:11706228-11706250 CAGTCCCTGCACTGGGACCCAGG - Intergenic
1180354028 22:11824385-11824407 CAGTCCCTGAACTGGGACCCAGG - Intergenic
1180384217 22:12167940-12167962 CAGTCCCTGAACTGGGACCCAGG + Intergenic
1182443368 22:30376746-30376768 CAGCCTCAGCCCTGGGCCACAGG - Exonic
1184235653 22:43181736-43181758 CAGCCTAAGAACTGGAACACTGG - Intronic
1185402522 22:50626268-50626290 TGGTCTCAGGTCTGGGACACAGG + Exonic
949724532 3:7028129-7028151 CAGGCTAAGCACTGGGAAACTGG - Intronic
950581845 3:13867481-13867503 CCGTCTCATTCCTGGGAGACAGG - Intronic
951605036 3:24423402-24423424 AAATCTCAGTGCTGGGAGACTGG - Intronic
952556218 3:34534309-34534331 CAGGCCCAGAATTGGGACACTGG + Intergenic
952635415 3:35523181-35523203 CTGGCTCAGTGATGGGACACCGG + Intergenic
953100696 3:39823359-39823381 CAATCTCACTACTGGGCTACTGG - Intronic
954462600 3:50636159-50636181 AGGTCCCAGTACTGGGATACGGG - Intronic
954649826 3:52154300-52154322 CAGTCTCCCCGCTGGGACACTGG - Intronic
954802269 3:53194115-53194137 TAGGCTCTGTTCTGGGACACTGG + Intergenic
956649930 3:71495222-71495244 CCTTCTCAGTACTGGGACTTAGG + Intronic
956848010 3:73201815-73201837 CAATCTCTCTACTGGGGCACAGG + Intergenic
958154356 3:89734824-89734846 CTTTCTCAGTAATGGGTCACAGG - Intergenic
964880689 3:161419510-161419532 CAGTTTCAAGACTGGGAAACTGG - Intergenic
968982742 4:3859390-3859412 CGGTCTAAGTACTGGGGCTCAGG + Intergenic
972601547 4:40577228-40577250 CAGTTTCAGTTCTGGGAAAGGGG + Intronic
973374143 4:49276265-49276287 CAGTCCCTGCACTGGGACCCAGG + Intergenic
973383269 4:49333974-49333996 CAGTCCCTGCACTGGGACCCAGG - Intergenic
973386877 4:49518989-49519011 CAGTCCCTGCACTGGGACCCAGG - Intergenic
978713164 4:111809902-111809924 GATTCTCAGTACTTCGACACAGG + Intergenic
983961380 4:173759282-173759304 CATTCTCAGAACTGGGAGACAGG + Intergenic
985817829 5:2139677-2139699 CAGGCTCATGACTGGGGCACAGG + Intergenic
986763639 5:10903190-10903212 AAGTCTCACTCCTGAGACACAGG + Intergenic
990560000 5:56974455-56974477 CAGGCTCATTCCTGGGAGACAGG + Intergenic
990649313 5:57880401-57880423 CAGTGACAAAACTGGGACACTGG - Intergenic
990987907 5:61658170-61658192 CAGTCTCATTACTGGAAAAAGGG + Intronic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
994130361 5:96220039-96220061 CAGTCTCTGTCGTGGGAGACAGG - Intergenic
995968760 5:117941414-117941436 CATCCTCTGAACTGGGACACTGG + Intergenic
996408137 5:123126993-123127015 CAGTCTAAGTTCTGGGAGCCAGG - Intronic
996671847 5:126127265-126127287 GAGTCTCTGAAATGGGACACAGG - Intergenic
996744132 5:126831125-126831147 AAGTCTCATTTCTGTGACACTGG + Intronic
997236466 5:132274887-132274909 CTGTCTCAGTACTGGCACCCTGG - Intronic
998936901 5:147238456-147238478 CAGTTTTAGGACTGGAACACAGG + Intronic
1001110368 5:168891211-168891233 CAGTCTCATGTCTGAGACACAGG - Intronic
1001312890 5:170623901-170623923 TGGCCTCAGTTCTGGGACACAGG - Intronic
1002162635 5:177324793-177324815 CCCTCTCAGTACTGCCACACTGG + Intergenic
1002259520 5:177984004-177984026 GAATCCCAGTACTGGGACCCTGG - Intergenic
1007472051 6:42097385-42097407 TACTCTCAGAAGTGGGACACTGG - Intergenic
1008508264 6:52252281-52252303 CAGTCTCTGTGCTGGGTAACAGG + Intergenic
1010456647 6:76064007-76064029 CAGCCTCAGTGCTGAGGCACAGG + Intronic
1012502996 6:99910878-99910900 CAATCCCACTACTGGGCCACAGG - Intergenic
1018198591 6:161376013-161376035 CAGTCCCAGTATTGGGAGATGGG - Intronic
1019390788 7:785734-785756 CAGTCTCACTGCTGGCACAGAGG - Exonic
1019597167 7:1863521-1863543 CAGCCTCAGTACTGGCTCCCGGG - Intronic
1019931313 7:4225172-4225194 CAGTCTCACAACTGGGACATGGG - Intronic
1021280293 7:18708635-18708657 AAGTCCCAGTATTGGGAGACAGG + Intronic
1024207134 7:47173395-47173417 CAGTCTCAGAAGCTGGACACAGG - Intergenic
1024506308 7:50165110-50165132 CAGCCTCAATCCTGTGACACTGG - Intergenic
1030989930 7:116287812-116287834 AAGTCACAGTATTGGGACCCAGG + Intronic
1033084334 7:138328430-138328452 CAGTCACAGTCCTGGCACCCAGG - Intergenic
1035648901 8:1249253-1249275 CAGACTCAGAAATGGGCCACTGG + Intergenic
1036145571 8:6251625-6251647 AAGTCTCAATGCTGAGACACGGG + Intergenic
1039681663 8:39744775-39744797 TACTTTAAGTACTGGGACACAGG - Intronic
1045842960 8:106600851-106600873 CTGTCTAATTACTGGGATACAGG + Intronic
1047950754 8:129932784-129932806 CAGACTGAGTTCTGGGACAAGGG + Intronic
1047960592 8:130008947-130008969 GAGCCTCAGTGCTGGGACTCAGG - Intronic
1048141992 8:131803719-131803741 CAGTCTGAGCACTGAGACACAGG - Intergenic
1050559109 9:6816323-6816345 CAGTGTCAGAAATGGTACACAGG - Intronic
1050726901 9:8660488-8660510 CAGACTCAGTAATAGGAGACAGG - Intronic
1053643437 9:40108212-40108234 CAGTCCCTGCACTGGGACCCGGG + Intergenic
1053762712 9:41357278-41357300 CAGTCCCTGCACTGGGACCCGGG - Intergenic
1054541315 9:66268392-66268414 CAGTCCCTGCACTGGGACCCGGG - Intergenic
1055813066 9:80174195-80174217 CAGTCTCTGTAATGTGACACTGG + Intergenic
1058265431 9:102893016-102893038 CAGAGTAAGTACTGGTACACAGG - Intergenic
1059116105 9:111600921-111600943 CATTCTGAGTACTGGGACTTGGG + Intergenic
1059716551 9:116918370-116918392 CAGCCTCAAGACTGTGACACAGG - Intronic
1061303930 9:129722019-129722041 CCAGCTCAGTGCTGGGACACAGG - Intronic
1062170277 9:135131085-135131107 AAGTCTCAGTTCTGGGAAGCAGG - Intergenic
1062186781 9:135222457-135222479 CAGCCACAGTACTGGGCCCCTGG + Intergenic
1203697817 Un_GL000214v1:114176-114198 CAGTCCCTGCACTGGGACCCAGG + Intergenic
1203551385 Un_KI270743v1:166810-166832 CAGTCCCTGCACTGGGACCCAGG - Intergenic
1187301789 X:18057994-18058016 TAGGCTCAGAACTGGCACACTGG - Intergenic
1190928197 X:54927218-54927240 CAGTATCAGTTCTAGGACACAGG - Intronic
1192334765 X:70209045-70209067 CAGTCCCAGGATTGGGACAGAGG + Intergenic
1193137506 X:77988559-77988581 CAGTTTAGATACTGGGACACTGG + Exonic
1197997586 X:132395079-132395101 CATTCTCAATACTGGGGCAGAGG + Intronic