ID: 906088716

View in Genome Browser
Species Human (GRCh38)
Location 1:43158864-43158886
Sequence GACTTCCAATTAAAGATCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 184}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906088713_906088716 17 Left 906088713 1:43158824-43158846 CCAGAAGAGTGAGTTTACATGCA 0: 1
1: 0
2: 1
3: 9
4: 177
Right 906088716 1:43158864-43158886 GACTTCCAATTAAAGATCTTAGG 0: 1
1: 0
2: 0
3: 7
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906088716 Original CRISPR GACTTCCAATTAAAGATCTT AGG Intergenic
900580151 1:3404797-3404819 GACTTCCAGTTGAAGGCCTTGGG - Exonic
901785240 1:11620291-11620313 GACTTCCAGTTCTGGATCTTTGG - Intergenic
904776272 1:32908983-32909005 GTCTTCCAATTTATGAACTTAGG - Intergenic
906088716 1:43158864-43158886 GACTTCCAATTAAAGATCTTAGG + Intergenic
908770270 1:67589610-67589632 GAATTCCTATTAAAGATCGTAGG - Intergenic
908923906 1:69230180-69230202 GACATCCACTGAAAGATTTTAGG - Intergenic
909467836 1:75993462-75993484 CAATTCCAACTAAAGATATTGGG + Intergenic
911313383 1:96325603-96325625 GTCTTCTAATTAAAGTTTTTAGG - Intergenic
911523161 1:98952466-98952488 CACTTCCAACTAAAGGTCCTAGG + Intronic
913094040 1:115499329-115499351 GGCTGCCCATTAAAGAACTTGGG - Intergenic
916147733 1:161755555-161755577 AAATTCCAATTAAACATTTTAGG - Intronic
916335592 1:163667561-163667583 AACTTCCAATTCAATATTTTGGG + Intergenic
916344541 1:163773066-163773088 TAGTTCCAATTAAAGAACTCTGG + Intergenic
916690205 1:167182969-167182991 GACTTCCCATTTAGGATCATTGG - Intergenic
921281332 1:213571030-213571052 GTCTTCCAATTATAGGTTTTTGG + Intergenic
1063175530 10:3547651-3547673 GACTTCAAATTTAAGAAATTTGG - Intergenic
1063786066 10:9384403-9384425 GTCTTCCAAAAATAGATCTTGGG + Intergenic
1071740936 10:88357323-88357345 AACTTCAAATTTAAGATCCTGGG + Intronic
1071765475 10:88659648-88659670 GTCTTCCATTTATAGATATTTGG - Intergenic
1073897101 10:108174568-108174590 GACTGCCAACTGTAGATCTTTGG + Intergenic
1074661518 10:115663913-115663935 GAATTCCAAGTAAACTTCTTTGG - Intronic
1077592490 11:3503352-3503374 GACTTCCACTTATAGAGCATTGG - Intergenic
1079330130 11:19526354-19526376 GAATTCCAATTACAGAACTGAGG - Intronic
1079787014 11:24685860-24685882 GACTCACAATTAAATTTCTTAGG - Intronic
1084248324 11:67876075-67876097 GACTTCCACTTATAGAGCATTGG - Intergenic
1085859506 11:80215393-80215415 GAATTCAAAATAATGATCTTAGG + Intergenic
1087663174 11:101011365-101011387 GACTACCAGTTTATGATCTTTGG + Intergenic
1088078577 11:105881508-105881530 GACTTTCAGTGAAAGATGTTGGG - Intronic
1088765633 11:112973402-112973424 GAAATCCAATGAAAGCTCTTTGG + Intronic
1090823861 11:130369572-130369594 GAGTCCCAATCAAAGAACTTAGG - Intergenic
1094006261 12:25755185-25755207 CAGATCCAATTAAAGATCTCTGG + Intergenic
1095706721 12:45244854-45244876 GACTTCCTATTAGGAATCTTTGG + Intronic
1096089767 12:48891092-48891114 GACTTCCAAATTAGGAGCTTAGG + Intergenic
1099688378 12:85919133-85919155 GTCTTCCAATTAAAGAATATAGG + Intergenic
1100515313 12:95321835-95321857 TGCTTGCAACTAAAGATCTTTGG + Intergenic
1101310005 12:103569142-103569164 GACTTCCAATACAAGAGCATGGG - Intergenic
1102640484 12:114362240-114362262 TGCTTCCAAATAAAGAACTTAGG + Intronic
1107151383 13:37116043-37116065 GACATCCAAGTAAAAATGTTGGG + Intergenic
1107739142 13:43430964-43430986 GACTTCTAAATGTAGATCTTTGG + Intronic
1108426606 13:50308432-50308454 GACTTCCAATGCTACATCTTTGG - Intronic
1109107005 13:58265930-58265952 GACTTCAAATTTAACATATTTGG - Intergenic
1109630816 13:65043929-65043951 GATTGCCAATTGAAAATCTTGGG - Intergenic
1110041820 13:70770540-70770562 AGCTTCCTATTAAAGGTCTTAGG + Intergenic
1110776824 13:79417395-79417417 GACATCCAAGTAATGACCTTTGG - Intergenic
1111460593 13:88536538-88536560 GCTTTCCAATTGCAGATCTTGGG - Intergenic
1111654751 13:91138632-91138654 GGCTTCCAATTAAAACTCTCAGG + Intergenic
1111936203 13:94559287-94559309 TACTTTCAATTAAAAATCTGGGG + Intergenic
1112539595 13:100295103-100295125 GATTTCAAAATAAAGATCTAAGG - Intronic
1112979596 13:105366236-105366258 GTATTCCAATTTAAGATATTTGG + Intergenic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1118933908 14:70268627-70268649 GAATTCCAATTTTAGATATTAGG + Intergenic
1118986195 14:70757149-70757171 GTCTTCCAATTCATGATCATGGG - Intronic
1119913857 14:78377104-78377126 TAATTCCAATTAAAGAGATTGGG + Intronic
1120351734 14:83369610-83369632 GATTTCCAATTATAGGTCTAGGG + Intergenic
1120387713 14:83866734-83866756 GACTTCCAAATATAAATTTTGGG + Intergenic
1121589388 14:95090675-95090697 GACTTCTAATTCAAGCTGTTTGG - Intronic
1121679145 14:95778235-95778257 GTTTGCCAATTTAAGATCTTGGG - Intergenic
1126578213 15:50218344-50218366 GATTTCCAATTAAATATATATGG - Intronic
1127574741 15:60280044-60280066 GAAATCCAACTAAAGATATTTGG + Intergenic
1128376595 15:67080904-67080926 GACTTCCAATAAATTATCTGGGG - Intronic
1130772722 15:86941008-86941030 GAATTACATTTAAAGATCTAAGG - Intronic
1131352271 15:91712207-91712229 TGCTTCAAATTAAAGTTCTTGGG - Intergenic
1131621729 15:94075210-94075232 GGCTGCAAATTAAATATCTTAGG + Intergenic
1131745966 15:95447560-95447582 GAATGCCAACTAAAAATCTTTGG - Intergenic
1132023311 15:98383273-98383295 GACTTTCACTTAAATGTCTTTGG + Intergenic
1133358039 16:5151324-5151346 GACTTCCACTTATAGAGCATTGG - Intergenic
1137458717 16:48638412-48638434 GACTTCCACATATAGATTTTGGG - Intergenic
1137678719 16:50319571-50319593 AACTGCCAATTAAAAATATTTGG + Intronic
1138851524 16:60635181-60635203 GACTTCCATTTATAGAGCCTAGG - Intergenic
1156440711 18:37184856-37184878 AACTTCCCATTAAAAATGTTTGG + Intronic
1156442926 18:37209802-37209824 CACTTCCAAGTAAAGATATCAGG + Intronic
1157482850 18:48066656-48066678 GACTTGCATTTGAAGATCTCAGG - Intronic
1160063584 18:75553571-75553593 CACTTTCAATAAAGGATCTTGGG + Intergenic
1164216220 19:23151633-23151655 GGCATCTAATTAAAGAACTTCGG + Intergenic
1168260947 19:55194198-55194220 GACATCTAATGACAGATCTTGGG - Intronic
925696468 2:6585358-6585380 AACTTCCTATTATAGAACTTAGG - Intergenic
928556431 2:32431103-32431125 GACTTAAAATTAATTATCTTGGG - Intronic
928580213 2:32699853-32699875 GACCTTCAAATAAAAATCTTAGG + Intronic
928916556 2:36477987-36478009 GACTTCAGATTGAAGATCTGGGG - Intronic
929472178 2:42205038-42205060 GACCTCGAATCAAAGTTCTTTGG - Intronic
929480126 2:42298259-42298281 GCCTGCCAAATAAAGATGTTTGG - Intronic
930395057 2:50811540-50811562 GAGTGCCAACTGAAGATCTTTGG - Intronic
930593734 2:53359958-53359980 TACCTCCAATTAAACATTTTGGG - Intergenic
931092779 2:58904119-58904141 CACTTCCCATTAAAAATCCTTGG - Intergenic
931503317 2:62895494-62895516 GACTTCCTTTGATAGATCTTGGG + Intronic
931842058 2:66162827-66162849 GACATCCAATTATTGATCTTAGG + Intergenic
932746479 2:74337874-74337896 CACTCTCATTTAAAGATCTTAGG - Intronic
937141008 2:119600091-119600113 GACTTCCACTGAAGGCTCTTAGG - Intronic
937732388 2:125249207-125249229 TGCTTCCAATCAAACATCTTTGG + Intergenic
942774386 2:179563999-179564021 GACGTACAAATAAAGAGCTTGGG - Intronic
945785525 2:214230972-214230994 TGCTTCCAATTTAAGATCTTTGG - Intronic
946140490 2:217686573-217686595 GATTTCCAAATCAAGATCTCAGG + Intronic
946658628 2:221976092-221976114 AACTTCCAAATAGAGATGTTAGG - Intergenic
946855931 2:223949720-223949742 GACTTACAATTAAATAACTAGGG + Intergenic
1169149403 20:3277460-3277482 GACTTCCAAATACGTATCTTAGG + Intronic
1169405459 20:5317681-5317703 GGCTGCCAATTAAAAATTTTTGG + Intergenic
1173013286 20:39201653-39201675 GACTTCCAATCAGAGGTCTGGGG - Intergenic
1173484024 20:43427248-43427270 GACATCCAATTAGAGATGTTTGG - Intergenic
1176689789 21:9891646-9891668 CATTTCTAATTAAAGATCTTAGG + Intergenic
1178421272 21:32445375-32445397 TATTTTCAAGTAAAGATCTTGGG + Intronic
1183502220 22:38187694-38187716 GACATCCAATTTAAGATCAGTGG - Intronic
1185412406 22:50690724-50690746 GTCTTCCAATTAATGAACATGGG + Intergenic
950932094 3:16800212-16800234 CACTTCCACTTACAAATCTTTGG + Intergenic
951066593 3:18273736-18273758 GAATACTAATTAAAGATCTCAGG - Intronic
951993227 3:28699310-28699332 GAAATCAAATTAAAGATCCTGGG + Intergenic
956650689 3:71501889-71501911 GACTTCCTGTTCAAGCTCTTTGG + Intronic
957062560 3:75493920-75493942 GACTTCCACTTATAGAGCATTGG - Intergenic
958869734 3:99543708-99543730 GAATACCAATTAAACAACTTTGG + Intergenic
960190136 3:114694204-114694226 GACTTCGCATAAAAGATTTTGGG - Intronic
961290840 3:125845497-125845519 GACTTCCACTTATAGAGCATTGG + Intergenic
961896285 3:130170698-130170720 GACTTCCACTTATAGAGCATTGG - Intergenic
962160393 3:132993098-132993120 GACTTTCTCTTAAGGATCTTTGG + Intergenic
962175659 3:133151422-133151444 GTTTTCCCATTAAAGATCTCTGG - Intronic
962866813 3:139453930-139453952 GCCTTCAAAATAAAGATCTCAGG + Intronic
963534083 3:146506258-146506280 GATTCCCAATTAAAAATATTGGG + Intergenic
963838978 3:150085379-150085401 AACTTGCATTTAAAAATCTTAGG + Intergenic
965473353 3:169122647-169122669 GACTTCCAGTTAAATGCCTTGGG + Exonic
966906992 3:184533485-184533507 GACTTCCAATTATAGCTCTGAGG - Intronic
970397977 4:15690045-15690067 GACTGCAAATTAGAGATGTTAGG - Exonic
970900624 4:21154747-21154769 GAGTTCCATTTAAAGAGCTTTGG - Intronic
971806367 4:31363126-31363148 GACTTCCAATTAGATATTATTGG - Intergenic
972447843 4:39163746-39163768 GACTTCCAAAAAAAGTCCTTTGG + Intergenic
977366681 4:96078069-96078091 GACTTCAAATTACAAATTTTTGG + Intergenic
978539501 4:109802164-109802186 GCCTTCCCATTAAAGAGCTGAGG + Exonic
980353201 4:131709590-131709612 CGTTTCTAATTAAAGATCTTAGG + Intergenic
980823793 4:138049923-138049945 GACTTGAAATTAAGGATATTTGG + Intergenic
981880426 4:149604707-149604729 GACTTCCTTTTAATGTTCTTAGG - Intergenic
984535670 4:180972087-180972109 GACTTCTGATTAAATTTCTTTGG - Intergenic
984834366 4:184006092-184006114 GCCTTCCAAATGATGATCTTAGG - Intronic
990326413 5:54680307-54680329 GACTTCCATTTAAATGTCATTGG + Intergenic
991266183 5:64720896-64720918 GACTACCATTTTAAGTTCTTAGG - Exonic
994596504 5:101844402-101844424 GACCTCCAAGTGAAGATATTGGG + Intergenic
995577090 5:113549214-113549236 GATTTCCAATTAAACATGGTAGG + Intronic
995844513 5:116479612-116479634 GACAGCCAATTAGAGATCTGTGG - Intronic
996108078 5:119530483-119530505 GACAGACAATTAAAGATCATGGG - Intronic
996606556 5:125329862-125329884 GACTTGAAATCAAAGATTTTAGG - Intergenic
996891192 5:128422826-128422848 GACTTCCAGTCAAAAAGCTTTGG + Intronic
998454153 5:142257774-142257796 GATTACCAATTGCAGATCTTGGG + Intergenic
998664005 5:144275051-144275073 GTCTTCCTATTAAAGATTTCTGG + Intronic
1000547288 5:162619014-162619036 TAGGTCCAATTAAAGGTCTTTGG + Intergenic
1002004837 5:176223862-176223884 GACTTGCACATAAAAATCTTTGG - Intergenic
1002221536 5:177686762-177686784 GACTTGCACATAAAAATCTTTGG + Intergenic
1007200521 6:40104588-40104610 TACTTACAATTAATCATCTTGGG + Intergenic
1007630703 6:43271739-43271761 GACTTACAAAGAAAGATTTTGGG - Intronic
1007899600 6:45398637-45398659 GACTTCAAGATAAAGATCTAAGG - Intronic
1008127389 6:47684284-47684306 GACTTGCAATTAAACAAATTAGG + Intronic
1010879247 6:81147923-81147945 AACTTCCACTTAAAGAACCTAGG - Intergenic
1011173759 6:84537025-84537047 TACTTCCATTTAAATATCATTGG + Intergenic
1013971779 6:116028810-116028832 GACTTCCACATAAAGACTTTGGG + Intronic
1015809150 6:137143733-137143755 AAATTCCAGTTAAACATCTTAGG - Intergenic
1017912382 6:158805053-158805075 GATTTCCAATTTCTGATCTTGGG + Intronic
1020985780 7:15132644-15132666 GACATCAATTTAAAAATCTTGGG + Intergenic
1022609124 7:31851036-31851058 AACTTCCAAATAAAGTTCCTAGG + Intronic
1022635319 7:32127217-32127239 GACTCCCAACTGCAGATCTTGGG + Intronic
1024439695 7:49402515-49402537 GACTTCCAATAGAAAATCTGGGG + Intergenic
1026074575 7:67155089-67155111 GAATTCAAAATAATGATCTTGGG - Intronic
1026702292 7:72657080-72657102 GAATTCAAAATAATGATCTTGGG + Intronic
1028344121 7:89759352-89759374 GAGTTCAAATTAAACAACTTTGG - Intergenic
1028664829 7:93329699-93329721 GACTTCCCATTAAAAAGCTATGG + Intronic
1028764503 7:94537054-94537076 GTCTTCTAATTAAAATTCTTTGG + Intronic
1029924275 7:104299218-104299240 GGCATCAAATTAAAGATGTTTGG - Intergenic
1031224804 7:119022132-119022154 GAATTCTAAATAATGATCTTAGG + Intergenic
1032228062 7:130049948-130049970 AAATTCGAATCAAAGATCTTCGG + Intronic
1032300380 7:130680903-130680925 AACTTCCCCTTAGAGATCTTGGG + Intronic
1036881248 8:12513891-12513913 GACTTCCACTTATAGAGCATTGG - Intergenic
1039900984 8:41752429-41752451 GACTTCCAAATATCTATCTTTGG + Intronic
1040063697 8:43127214-43127236 GAATTCAAAATAATGATCTTAGG - Intergenic
1041077641 8:54183854-54183876 GACATCCAAGAACAGATCTTAGG - Intergenic
1041231025 8:55752245-55752267 AACTTCTCATTAAAGATCTGAGG + Intronic
1044122778 8:88418420-88418442 GACTTCAACATAAAAATCTTTGG - Intergenic
1045152932 8:99429478-99429500 GACATCCAAGTAAAGATATAAGG - Intronic
1047037550 8:120956024-120956046 CACATCCAATTAAAGACCTGTGG - Intergenic
1047672127 8:127159495-127159517 GTCTTGCTATTAAAGACCTTGGG + Intergenic
1047920295 8:129628384-129628406 GACTGCCAAATGAAAATCTTTGG - Intergenic
1048037046 8:130686761-130686783 GTCATCCAATTAATGAGCTTTGG + Intergenic
1050892396 9:10839966-10839988 AACTTCCAAATATATATCTTAGG - Intergenic
1050974339 9:11917374-11917396 GTCTTCCAATTTATGATCATGGG + Intergenic
1051373266 9:16377131-16377153 TTCTTCCAAATAAACATCTTAGG + Intergenic
1052007451 9:23366062-23366084 GACTTCCAATTCTGTATCTTTGG - Intergenic
1053206786 9:36192882-36192904 ATCTTCCAACTACAGATCTTGGG - Intronic
1053779471 9:41589827-41589849 CATTTCTAATTAAAGACCTTAGG - Intergenic
1054167427 9:61800068-61800090 CATTTCTAATTAAAGACCTTAGG - Intergenic
1054670115 9:67780832-67780854 CATTTCTAATTAAAGACCTTAGG + Intergenic
1056016928 9:82399266-82399288 GACGTCCAATTAAAGGTGGTAGG + Intergenic
1060777588 9:126387105-126387127 GACTGCAAATTAAAGTTCATAGG + Intronic
1186947074 X:14580411-14580433 GACTTCTACTCAAAGACCTTAGG - Intronic
1189095357 X:38132749-38132771 GCCTTGCAATTAATGATCTCTGG - Intronic
1193404014 X:81080448-81080470 TTCTTCCAATTAATGATCATGGG - Intergenic
1195393348 X:104385988-104386010 GACTTCCAAATCTAGATCTCAGG - Intergenic
1195526272 X:105893588-105893610 AACTTCCAGTTAAATATCTCTGG + Intronic
1196216336 X:113056383-113056405 GACTTTCAATTAGTGATATTGGG - Intergenic
1199185202 X:144908430-144908452 GACCCCCAATTAAAAATTTTTGG - Intergenic