ID: 906093313

View in Genome Browser
Species Human (GRCh38)
Location 1:43201360-43201382
Sequence CAGTGGTACTAGATGTCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 96}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906093308_906093313 14 Left 906093308 1:43201323-43201345 CCAAGGAACTAAACAATTTCTGA 0: 1
1: 0
2: 0
3: 22
4: 242
Right 906093313 1:43201360-43201382 CAGTGGTACTAGATGTCAGAGGG 0: 1
1: 0
2: 1
3: 10
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906093313 Original CRISPR CAGTGGTACTAGATGTCAGA GGG Intronic
904582496 1:31556131-31556153 CAGTATTACTAGAGGTAAGATGG - Intergenic
906093313 1:43201360-43201382 CAGTGGTACTAGATGTCAGAGGG + Intronic
909668888 1:78165916-78165938 CTGTGGTAGAAGCTGTCAGAGGG - Intergenic
910455384 1:87392251-87392273 CAGTGGTACTTGGAGTGAGAAGG - Intergenic
911467112 1:98269536-98269558 CAGAGGTAATACATGTCAAATGG - Intergenic
913218733 1:116642799-116642821 CAGTAGTAGCAGATGTCAGCAGG + Intronic
917326432 1:173837245-173837267 CTATGGTAGTAGATGTGAGAGGG + Intronic
918471468 1:184880168-184880190 CAGAGGAACTGGATGTTAGAAGG - Intronic
922193237 1:223338351-223338373 CAGTTGTACTAAATGGCTGAAGG - Intronic
1064130608 10:12706373-12706395 CTGTGGTACTGAATTTCAGAAGG - Intronic
1072608858 10:97003706-97003728 CAGTGGTTCTGGGTCTCAGAGGG + Intronic
1074551330 10:114445079-114445101 CATTGGTGCTGGAGGTCAGAGGG - Intronic
1074677778 10:115871521-115871543 CAGTGGAATTAGATTTCAAATGG - Intronic
1078028432 11:7722456-7722478 CAGTGGTTCAAGATGGGAGAGGG + Intergenic
1080504756 11:32901726-32901748 CGTTGGTACTAGATTTTAGAGGG + Intronic
1081780948 11:45712204-45712226 CTGTGGTACTATATTTCAGGGGG + Intergenic
1085172360 11:74460148-74460170 CACAAGTACTAGATGTCAGAAGG - Intronic
1088680452 11:112237096-112237118 CAGTGGAAATAGATGGAAGAAGG + Intronic
1095598081 12:43981617-43981639 TAGAGGTATTAGAAGTCAGAAGG - Intronic
1095628455 12:44345188-44345210 CAGTGGGACTCACTGTCAGAAGG + Intronic
1097287922 12:57891957-57891979 CAGGGGTACCAGATGTAAGGGGG + Intergenic
1098841190 12:75479997-75480019 CAGTGGTAAGAGCTGTGAGATGG - Intergenic
1099311341 12:81028348-81028370 CAGTGGCACTAGATCTCAGAGGG + Intronic
1102945421 12:116983247-116983269 CAGTGGCTCTACATATCAGATGG - Intronic
1107153407 13:37139064-37139086 CTGTGGTCCTGGATTTCAGAAGG + Intergenic
1107321776 13:39196941-39196963 AAGTGGTAGTAGATTTCAGTTGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112298304 13:98208513-98208535 CAGTGTTACCAGATGACATATGG - Intronic
1112322171 13:98417612-98417634 CAGGGGTAAGAGATGTGAGAAGG + Intronic
1112559965 13:100504032-100504054 GAGTGGGATTAGATGTGAGAGGG + Intronic
1112953032 13:105025895-105025917 CAGTGGAAATAGACTTCAGAAGG - Intergenic
1124097003 15:26658033-26658055 CAGTGGTACTAGTTATCCGTAGG - Intronic
1134263160 16:12670171-12670193 CTGTGGTCCTAGATCTCAGGAGG + Intronic
1141045192 16:80709707-80709729 CTGTGGAAGTAGATGTGAGAAGG - Intronic
1141514445 16:84534524-84534546 CAGTGAACCTGGATGTCAGATGG + Intronic
1152306471 17:79523824-79523846 GAGTGGTCCTTGATTTCAGAAGG + Intergenic
1152925693 17:83086830-83086852 CAATGGTTCTAGTTGTCAGCTGG + Intronic
1153219954 18:2852910-2852932 CACAGGTACTAGATGTGAGGAGG + Intronic
1158327879 18:56329828-56329850 CAGTGGTACTTGATGTCCGTTGG - Intergenic
1164480092 19:28604924-28604946 CAGTGGTACAAGGCCTCAGAGGG + Intergenic
929520817 2:42649073-42649095 GAGTGGTACTAGAGGCCAGGGGG - Intronic
932105588 2:68938270-68938292 CAGTGGAACTAGATGCTTGAAGG - Intergenic
944533289 2:200685157-200685179 TAATGTTAATAGATGTCAGAGGG - Intergenic
945480100 2:210335526-210335548 CAGTGTCACTACATGTGAGATGG + Intergenic
946156827 2:217812475-217812497 CAGTGATACTGGAAGCCAGAAGG + Intronic
947628041 2:231633368-231633390 GGGTGGTGCTGGATGTCAGATGG + Intergenic
948177744 2:235957463-235957485 CAGAGGTACACAATGTCAGAGGG - Intronic
1169538970 20:6579651-6579673 CAGTGGTGCTAGCTGCCCGAAGG - Intergenic
1170780072 20:19417430-19417452 CAGTTGTACAAGATGTCAAGTGG + Intronic
1172979278 20:38928660-38928682 CACTGGAACTAGAGGCCAGAGGG + Intronic
1173228644 20:41177116-41177138 CAGTGGTACCAGAAGGTAGATGG + Intronic
1174539733 20:51279518-51279540 CAGTGATATAAGATGTCAAAAGG - Intergenic
1175444512 20:59010752-59010774 CAGTGGTGCTTGAGGGCAGAGGG + Intergenic
1179469336 21:41600167-41600189 CTGTGCTACTAGATGTGAGCAGG + Intergenic
1180820032 22:18820861-18820883 CAGTAGTAGCAGATGTCAGCAGG + Intergenic
1181206254 22:21255333-21255355 CAGTAGTAGCAGATGTCAGCAGG + Intergenic
1184306266 22:43604501-43604523 CAGTGGGATGCGATGTCAGAGGG - Intronic
1184553148 22:45216284-45216306 CAGTGGTTCTACCTGTCAGATGG + Intronic
1203220666 22_KI270731v1_random:40090-40112 CAGTAGTAGCAGATGTCAGCAGG - Intergenic
1203270158 22_KI270734v1_random:46732-46754 CAGTAGTAGCAGATGTCAGCAGG + Intergenic
952935562 3:38395845-38395867 CACTGGCACTAGATGTGAGAAGG - Intronic
956963189 3:74427339-74427361 CAGTAGTAGTAGCAGTCAGAGGG + Intronic
957133293 3:76250551-76250573 CAGTGCTAGCACATGTCAGATGG - Intronic
959503141 3:107130108-107130130 GAGTGTGACTAGGTGTCAGAAGG + Intergenic
964116901 3:153145856-153145878 CAGTAGTTCTAAATGTCTGAGGG - Intergenic
964713331 3:159695453-159695475 AAGTGGTTCTAGGAGTCAGAAGG - Intronic
966104295 3:176317258-176317280 CAGTGGTCTTAGCTGTCACATGG - Intergenic
984841672 4:184073885-184073907 CTGTGTTACTAAATGTCATAGGG - Intergenic
986545376 5:8891413-8891435 CAGTGTTCCTGGATGGCAGAAGG - Intergenic
987007925 5:13730032-13730054 TAGTAGTACTAGATGTTTGAAGG + Intronic
987156552 5:15095366-15095388 CAGTGGTTCTGCATATCAGAAGG - Intergenic
989355665 5:40541185-40541207 AAGTGGAATCAGATGTCAGAAGG - Intergenic
990782345 5:59379261-59379283 CAGTGGTGCTAAAAGTCAGAAGG - Intronic
991511001 5:67376221-67376243 CAGTGGGAACAGATGACAGATGG - Intergenic
992608008 5:78481157-78481179 CATTGGTACTGGATGTCATCTGG + Intergenic
993894247 5:93512166-93512188 CAGTGGGACAAGATGTGGGATGG + Intergenic
994466681 5:100143388-100143410 CAGTTGTACTAGATGTTTTAAGG - Intergenic
996090020 5:119341495-119341517 CAGTGATAGTTGAAGTCAGATGG - Intronic
1001671874 5:173480493-173480515 CTGTGAAACTATATGTCAGATGG - Intergenic
1001791922 5:174465037-174465059 CAGTGGTGCTAGCTGTGAGGAGG - Intergenic
1006993417 6:38235494-38235516 CAGTGGTACTGGGAGCCAGATGG - Intronic
1015284679 6:131472070-131472092 CATTGATACTAGAAGTAAGATGG + Intergenic
1022388580 7:29924373-29924395 AAGTGGTCTTGGATGTCAGAAGG - Intronic
1022791465 7:33693430-33693452 CAGTGGTACTAAAGGTTAGGAGG + Intergenic
1024721396 7:52140828-52140850 GAGTGGTAGAAGAGGTCAGAGGG - Intergenic
1026501654 7:70947860-70947882 CAGTGGCACTGGTAGTCAGATGG - Intergenic
1030580312 7:111346956-111346978 CTGTGATAATAGATGGCAGAGGG + Intronic
1032789767 7:135233670-135233692 CAGTGTTACAAGTTGTCCGAAGG - Intronic
1034450504 7:151134769-151134791 CAGTTGATCTGGATGTCAGATGG + Intronic
1034919523 7:155068505-155068527 CAGAGGTACCATATGGCAGACGG + Exonic
1037527440 8:19740473-19740495 CACTGGTACTGGATGTGTGAGGG - Intronic
1038663798 8:29520123-29520145 CAGAGGTACTCAATGTCAGAAGG + Intergenic
1038761607 8:30389343-30389365 CAGTGGCATTAGTTTTCAGATGG + Intronic
1041994231 8:64033887-64033909 CAGTGGGACAAGATGTAATACGG + Intergenic
1045520260 8:102897124-102897146 CAGAGGCATTAGCTGTCAGAGGG + Intronic
1046549351 8:115694083-115694105 CAGTGGCATTAGATGTGAGATGG - Intronic
1050564806 9:6870909-6870931 CTGTGGTCCTGGATGTCACAAGG + Intronic
1058434555 9:104950359-104950381 CAGTGGGACAAGATGTGAGGTGG - Intergenic
1059205213 9:112458081-112458103 CAGTGGCACTAGAAGGTAGATGG - Intronic
1059420796 9:114190724-114190746 AGGTGGTACTAGAAGACAGATGG - Intronic
1059446361 9:114340669-114340691 CAGTGCTACTAGGGGGCAGATGG + Intronic
1062156478 9:135051616-135051638 CAGTTGTAGTAGAGCTCAGAAGG - Intergenic
1187571534 X:20508619-20508641 TAGTGGTAGAAGATGCCAGATGG + Intergenic
1188233136 X:27690956-27690978 CAGTGGTATTTGATGACACATGG - Intronic
1190566846 X:51739147-51739169 CAGTGATGCTAGATGTAAGATGG + Intergenic
1193470398 X:81894952-81894974 CAGTTGTACTAGGTTGCAGACGG + Intergenic
1196113579 X:111973210-111973232 CAGTGGAAATAGATGTAGGAGGG - Intronic
1199525761 X:148790104-148790126 CAGTGGTACTGGTTGTCAAATGG + Intronic