ID: 906095030

View in Genome Browser
Species Human (GRCh38)
Location 1:43217104-43217126
Sequence GAGTGTGTGCAGAGGGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 545
Summary {0: 1, 1: 0, 2: 3, 3: 54, 4: 487}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906095022_906095030 20 Left 906095022 1:43217061-43217083 CCTTCCAGGACAAATGGACAAGG 0: 1
1: 0
2: 0
3: 8
4: 165
Right 906095030 1:43217104-43217126 GAGTGTGTGCAGAGGGATGAGGG 0: 1
1: 0
2: 3
3: 54
4: 487
906095026_906095030 -4 Left 906095026 1:43217085-43217107 CCAGTGAGCAATGAGCAGTGAGT 0: 1
1: 0
2: 0
3: 15
4: 168
Right 906095030 1:43217104-43217126 GAGTGTGTGCAGAGGGATGAGGG 0: 1
1: 0
2: 3
3: 54
4: 487
906095025_906095030 16 Left 906095025 1:43217065-43217087 CCAGGACAAATGGACAAGGGCCA 0: 1
1: 0
2: 0
3: 9
4: 157
Right 906095030 1:43217104-43217126 GAGTGTGTGCAGAGGGATGAGGG 0: 1
1: 0
2: 3
3: 54
4: 487

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906095030 Original CRISPR GAGTGTGTGCAGAGGGATGA GGG Intronic
900307964 1:2020055-2020077 GAGTGTGTGCAGGTGGACGGCGG + Intronic
900337092 1:2169685-2169707 GGGTGCGCACAGAGGGATGACGG + Intronic
901010978 1:6201957-6201979 GGGTGTGGGGTGAGGGATGAGGG - Intronic
901510238 1:9714790-9714812 GAGTGTGTGCCCTGGGGTGACGG - Intronic
902112046 1:14089073-14089095 GTGTGGGTGCAGAGGGAATATGG - Intergenic
902112964 1:14098600-14098622 CAGTCTGGGCAGAGGGATGCTGG - Intergenic
902482163 1:16717744-16717766 GGGTGAGTGCTGAGGGAGGAAGG - Intergenic
902490625 1:16778250-16778272 GAGAGTGGACTGAGGGATGAGGG + Intronic
903668067 1:25019866-25019888 GTGTGTGTGCACAGGCATGTAGG - Intergenic
904041994 1:27590491-27590513 GGGTGTGTGCTGAGGGGTGGTGG - Intronic
904327212 1:29734704-29734726 GACTTTGTGGACAGGGATGATGG - Intergenic
904601087 1:31672945-31672967 GAGTGTGGGAGGAGGGAAGACGG - Intronic
905265065 1:36746686-36746708 GACTGTGGGGAGAGGGGTGAGGG + Intergenic
905272345 1:36795278-36795300 GAGTGTGTGGATGGAGATGAGGG + Intergenic
905416527 1:37808147-37808169 GCGTCGGTGCAGGGGGATGAGGG - Exonic
906064161 1:42968311-42968333 TAGTGGGTTCAGATGGATGATGG - Intergenic
906095030 1:43217104-43217126 GAGTGTGTGCAGAGGGATGAGGG + Intronic
906868263 1:49447078-49447100 GGGTGTGTGCAGTGGGAAGAGGG + Intronic
907155821 1:52332849-52332871 GTGTGTGTACAGAATGATGATGG + Exonic
907385516 1:54122914-54122936 GAGTGTGTGCAGGGGGAACCTGG + Intergenic
908252740 1:62277919-62277941 GAGAATGTGCAAAGGGATGGAGG + Intronic
909501976 1:76344935-76344957 TAGTGTGTGCAGAGGAAGGCTGG - Intronic
909790244 1:79668253-79668275 GTGGGTGTGCATAGGGAAGAAGG - Intergenic
910705168 1:90121987-90122009 GTGTGTGTATAGTGGGATGATGG + Intergenic
910714124 1:90211953-90211975 GAGAGGGTGGAGAGGAATGAAGG - Intergenic
911333635 1:96554949-96554971 GAATGTGTGTAAAGGCATGATGG - Intergenic
911520650 1:98926187-98926209 TAGAGTGTGCAGAGTGCTGAGGG - Intronic
912362766 1:109108571-109108593 GAAGGTGTGGAGTGGGATGAGGG + Intronic
912516643 1:110220478-110220500 GAGGGTGAGCAGAGGGAGGGAGG - Intronic
913498289 1:119448151-119448173 GAGTGATTGAAGAGAGATGAGGG + Intergenic
914784742 1:150818056-150818078 GAGGGGGTGGAGAGGGAGGAAGG + Intronic
914963125 1:152224515-152224537 GAGTGTGTGCAGGGACATCATGG + Intergenic
915067602 1:153239491-153239513 CAGGGTTTGCAGAGGCATGAGGG - Intergenic
915091376 1:153428659-153428681 ATGTGTGGGCAGAGGGAGGAGGG + Intergenic
915278290 1:154804888-154804910 CAGTGTGTGCAGAGGGTTGGAGG - Intronic
915572034 1:156750086-156750108 GAGTGGGTACAGAGCGAGGAAGG + Intronic
916403608 1:164475118-164475140 GACAGTGGGCAGAGGGATGGCGG + Intergenic
916653482 1:166851788-166851810 GAATGTGTGAAGATGGTTGACGG - Exonic
916715133 1:167441481-167441503 GGGTGTGTGTAGTGGGAGGAGGG - Intronic
917530592 1:175831490-175831512 GAGAGTGGGCTGAGGGAAGATGG + Intergenic
917679862 1:177354821-177354843 GGATGTGTACAGAGAGATGAGGG + Intergenic
918260093 1:182787914-182787936 GTGTGTGTGAAGAGGCAGGAGGG - Intergenic
918480835 1:184974873-184974895 GTGTGTGTGTAGAGGGGTGGTGG - Intergenic
919652881 1:200167517-200167539 TAGTGTGTGCAGGAGGGTGAGGG - Intronic
919770020 1:201152132-201152154 GAATGCGGGGAGAGGGATGAGGG + Intronic
920092461 1:203464318-203464340 AAGTGTGGGCAGAAGGAGGAAGG - Intergenic
920379301 1:205526541-205526563 GAGTGGGAGTAGTGGGATGAGGG + Intronic
920430014 1:205912736-205912758 AAAGGTATGCAGAGGGATGATGG + Intergenic
922434452 1:225590070-225590092 GTGTGTGTGTTGAGTGATGAGGG - Intronic
922613086 1:226944251-226944273 AAGTGTGTGCCGAGGGAGCAGGG + Intronic
922825734 1:228516881-228516903 GACTGTGTGCATAGGGATTCCGG + Intergenic
923482378 1:234397318-234397340 GAGTGGGAGGAGAGGGAGGAGGG + Intronic
923529818 1:234804285-234804307 GAGAGTGGACTGAGGGATGAGGG - Intergenic
924116719 1:240754279-240754301 GAGACTGAGCAGAGGGAAGAGGG - Intergenic
1062952238 10:1513427-1513449 GAGTGTGTGGCTAGCGATGACGG + Intronic
1062979347 10:1708886-1708908 GTATGTGAGCAGAGGGCTGAGGG + Intronic
1063958180 10:11284489-11284511 GAGTGTGTGGTGGGGGATGAGGG + Intronic
1065076470 10:22084527-22084549 GAATGTCTGCAGAGGGAGGGAGG + Intergenic
1065125095 10:22566460-22566482 GAGTGTGCGTAGAGGGAAGGGGG - Intronic
1065178828 10:23104840-23104862 GAGAGTGTGGGGAGGGATGACGG - Intronic
1065771648 10:29083737-29083759 GAGTGTGTGCAGTGGAATATAGG + Intergenic
1065974381 10:30829532-30829554 CAATGTGTGCAAAGGGATAAGGG + Intronic
1066935175 10:41820953-41820975 TAGTGTCTGCAGAGGGATATTGG - Intergenic
1067168719 10:43886166-43886188 GAGTGTGGGCAGAGGGCAGGTGG + Intergenic
1067517408 10:46963580-46963602 ATGTGTGTACAGAGGGATGAGGG + Intronic
1067644840 10:48088249-48088271 ATGTCTGTACAGAGGGATGAGGG - Intergenic
1067797867 10:49333835-49333857 TGGTGGGTGCAGATGGATGATGG - Intergenic
1067800266 10:49353786-49353808 GAGGGTGTGGGGAGGGATGCTGG - Intergenic
1068520420 10:58071302-58071324 GAGTTTTTGGCGAGGGATGATGG - Intergenic
1068753605 10:60624957-60624979 GTGTGTGTGCACAGGGAAGAAGG - Intronic
1069805661 10:71122666-71122688 GAGTATGTGCAGTGGGGTGATGG + Intergenic
1070159652 10:73858531-73858553 GAGGGTGGGCAGAGGGAAGGGGG - Intronic
1070395217 10:76006271-76006293 GAGGGTGTTCAGAGGAGTGAGGG + Intronic
1070559681 10:77556758-77556780 TATTGTGTGCGGAGGGAAGATGG - Intronic
1070877084 10:79825370-79825392 TGGAGTGTGCAGAGGGATAAGGG + Intergenic
1071499355 10:86192510-86192532 CAGTGGGTGCTGAGGGCTGAAGG + Intronic
1071643579 10:87341414-87341436 TGGAGTGTGCAGAGGGATAAGGG + Intergenic
1072570077 10:96650833-96650855 GGGAGTGTGGAGAGAGATGAGGG + Intronic
1073401770 10:103263347-103263369 GAGCTCATGCAGAGGGATGAAGG + Intergenic
1073605919 10:104895544-104895566 GAGTGTGAGCTGAGGGATGCTGG - Intronic
1074270406 10:111947915-111947937 GAGTGTGGGGAGTGGGAGGAGGG + Intergenic
1074629829 10:115239940-115239962 GAGTGGGAGTTGAGGGATGAAGG + Intronic
1074763914 10:116686784-116686806 TGGTGTGGGAAGAGGGATGAGGG - Intronic
1074763934 10:116686847-116686869 TGGTGTGGGAAGAGGGATGAGGG - Intronic
1074763943 10:116686880-116686902 CAGTGTGGGAAGAGGGATGAGGG - Intronic
1076561957 10:131372881-131372903 GAGGGTGTGGAGAGTGCTGATGG - Intergenic
1076706763 10:132306648-132306670 GATAGCGTGCAGAGGTATGATGG - Intronic
1076810453 10:132883895-132883917 GAGTGAGTGCTGATGGATGCAGG + Intronic
1077045570 11:543670-543692 GAGTGAGTGCAGATGGCTGCGGG - Intronic
1077308048 11:1876621-1876643 AAGTGTCTGCAGGGGGAGGACGG + Intronic
1077819121 11:5718561-5718583 GAGTGTGTACATAGGTATGTAGG - Intronic
1078604306 11:12761638-12761660 GAGGGTGGGCAGAGGGATGATGG + Intronic
1078655875 11:13238575-13238597 GAGGGTGGGCAGCGGGAGGATGG + Intergenic
1078664530 11:13313707-13313729 GAATGTGGGCAGTGGAATGAGGG - Intronic
1079043159 11:17077542-17077564 GAGTGTGGGCAGCGGGCCGAGGG - Intronic
1079158323 11:17969520-17969542 GAGTGTGGGTGGAGGGGTGAGGG + Intronic
1080774125 11:35370021-35370043 CAGTGTGGGCAAAGGCATGAAGG + Intronic
1082182132 11:49132956-49132978 GAGTGTGGGCAGAGTGATGTAGG - Intergenic
1082767418 11:57180555-57180577 CAGTGTGTGGAAAGGGATGCTGG + Intergenic
1083236982 11:61357284-61357306 GAGTGTGGGCAGTGGAGTGAAGG - Exonic
1083682311 11:64357273-64357295 GAGTGTGTGGACAGGGGGGATGG + Exonic
1084531056 11:69728000-69728022 GTGTGTGTGCATATGGATGCGGG + Intergenic
1084581881 11:70029268-70029290 GCCTGTGTGCAGAGGGAAGAGGG - Intergenic
1084582468 11:70032510-70032532 GAGAGTGAGCAGAGGGAGGCGGG + Intergenic
1084941476 11:72615519-72615541 GAGTGTGGGGAGGGGGAGGATGG + Intronic
1084951222 11:72666652-72666674 CAATGTGAGCACAGGGATGAGGG - Intronic
1085294644 11:75424187-75424209 GTGTGTGTGTTGAGGGGTGAGGG - Intronic
1085787826 11:79470629-79470651 AAGGGGGTGCAGAGGGATAAAGG - Intergenic
1086672757 11:89567589-89567611 GAATGAGTGCAGAGGGAAGGGGG + Intergenic
1086683373 11:89701992-89702014 GAGTGTGGGCAGAATGATGTAGG + Intergenic
1087434143 11:98091206-98091228 CTGTGTGTGTAGGGGGATGAAGG + Intergenic
1089190143 11:116647833-116647855 TAGTGTGTGCAGAGGGAAAACGG + Intergenic
1089853342 11:121518843-121518865 GATTGTGTGGAGATGGTTGATGG + Intronic
1090353283 11:126121550-126121572 GGGAGTGTGCAGAGGGAGGAGGG + Intergenic
1090356907 11:126146560-126146582 AGGTCTGTGCAGAGGGATGAGGG - Intergenic
1090905347 11:131069616-131069638 GAGGGGGTGAAGAGGGGTGAGGG - Intergenic
1091182947 11:133623427-133623449 GACTGTGTGCAATGGGAAGATGG + Intergenic
1091600404 12:1914530-1914552 GAGTGGATGCAGTGGGATGCAGG - Intronic
1092252981 12:6911506-6911528 GTGTGTGTGGAGGGGGGTGAGGG + Intronic
1092776056 12:11946103-11946125 GAGTGGGTACAGAGGAAGGATGG + Intergenic
1092783885 12:12010731-12010753 GAGTGTGTGTTTAGGGAAGATGG - Intergenic
1093357866 12:18191086-18191108 GAGTCTGTGTAGTGGGAGGATGG - Intronic
1093853735 12:24072552-24072574 AAGTGTGTCCTGGGGGATGACGG + Intergenic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1094537880 12:31337964-31337986 GTGGGTGTGCAGAGCGATGCTGG - Intergenic
1095279075 12:40328135-40328157 GGGTATGTGTAGAGGGAAGACGG + Intronic
1095359512 12:41319468-41319490 CAGTTTGTGCAGAATGATGAGGG - Intronic
1096270950 12:50166402-50166424 GAGTGTGTTCGAAGGGATGGAGG - Intronic
1096429391 12:51530791-51530813 GTGTGTGTGCGGTGGGATGGGGG + Intergenic
1097419659 12:59358947-59358969 GAGAGTGTGATGAGGGATCAAGG + Intergenic
1098910503 12:76203969-76203991 GGGTGTCTCCAGAGGGATCATGG + Intergenic
1099097866 12:78398130-78398152 GACTGTGGGCTGAGAGATGATGG - Intergenic
1100383713 12:94085953-94085975 GAGGATGTGCATAGGGAAGATGG + Intergenic
1101921756 12:108938750-108938772 GAGTGTGTGCATATGGAGTAGGG - Intronic
1102457891 12:113082205-113082227 GCGTGGGTGGGGAGGGATGAGGG - Intronic
1102506917 12:113389548-113389570 AAGGCTGTGCAGATGGATGATGG - Exonic
1102537163 12:113590163-113590185 GAGTCTGTGCCCAGGAATGATGG - Intergenic
1102645478 12:114400924-114400946 GAGTGTGTGAAGGGGGAGGGTGG - Intronic
1102722522 12:115029808-115029830 GGGTGTGTACATAGGGGTGAGGG - Intergenic
1103851307 12:123935277-123935299 GAGAGGGTGCAGAGGGATAAAGG - Intronic
1104601152 12:130154343-130154365 GAGTGGGTGCAGAGAGCTGAGGG - Intergenic
1104655302 12:130569958-130569980 GAGTGTGTGCAGAGTAAGGTAGG - Intronic
1106346666 13:28886130-28886152 GAGTGAGGTCAGAGGGATGTAGG + Intronic
1107553803 13:41500190-41500212 GAGTGAGTGCTAATGGATGAAGG - Intergenic
1108522713 13:51259931-51259953 GGGTGTGTGCAGGAGGCTGAGGG + Intronic
1108529449 13:51315307-51315329 GTGTGTGTGTAGGGGGTTGAGGG - Intergenic
1108606006 13:52039255-52039277 GGGAGTGAGCTGAGGGATGAGGG + Intronic
1109725703 13:66338632-66338654 GTGTGTGTGTAGAGGGGTGGGGG + Intronic
1110545205 13:76748352-76748374 GAGTGTGTGAATAGGGAGAAAGG - Intergenic
1110571275 13:77007397-77007419 TAGTGTGTGCAAATGGATTACGG - Exonic
1110630380 13:77698898-77698920 CAGTGTTTTCGGAGGGATGACGG + Exonic
1111414854 13:87926822-87926844 GAGGGTGTGGAGTGGGAAGAGGG + Intergenic
1112167531 13:96935617-96935639 GAGTGTTTCCACAGGCATGACGG - Intergenic
1113169301 13:107481690-107481712 GAGTGTGTGAAGTGTTATGAGGG + Intronic
1113548533 13:111173838-111173860 GGGTGTCTGTAGAGGGATGTGGG + Intronic
1113677454 13:112216299-112216321 GATTGTGGGCCGGGGGATGAGGG + Intergenic
1113865277 13:113517862-113517884 GAGTGTGGGTGGAGGGAAGAGGG + Intronic
1116677841 14:47927849-47927871 GAAAGTGTCCAGAGGGAAGAAGG + Intergenic
1117245860 14:53886130-53886152 GAGGGGGTGGAGTGGGATGAGGG - Intergenic
1117330547 14:54707702-54707724 GGGTGTGAGCAGAGAGTTGAAGG + Intronic
1117997975 14:61496057-61496079 GAGAGTGCGCAGTGGGATCAAGG + Intronic
1118693763 14:68364213-68364235 GAGTGGGCGCAGAGGGAGGGAGG - Intronic
1119181109 14:72605829-72605851 GAGGTTGTGCAGAGTGATGATGG - Intergenic
1119264398 14:73255460-73255482 GACTGTGTGCTGAGGGAAGGAGG + Intronic
1119931722 14:78553998-78554020 GAGTGTGTGGAGGGAGATGAAGG + Intronic
1121539170 14:94712212-94712234 GGGTGAGTGCAGAGAGAGGAAGG - Intergenic
1121836326 14:97095896-97095918 GAATCTGTGCAGATGCATGAGGG - Intergenic
1122141611 14:99666387-99666409 CTGTGTGTGCAGAGGGTTGGGGG + Intronic
1122328060 14:100894575-100894597 TACTGTGTGCTGAGGGAAGATGG - Intergenic
1122819618 14:104334951-104334973 GGGTGTGTGCGGAGGGCTGTGGG - Intergenic
1122892157 14:104737253-104737275 GAGTGGCTGCCGAGGGTTGAGGG - Intronic
1124066107 15:26345631-26345653 GAGTGACTGAAGAGGGATGTGGG + Intergenic
1124079427 15:26477651-26477673 AAGTGTGGGCAGAGGGGTGCAGG - Intergenic
1124742625 15:32312917-32312939 GAGTGGGCGCAGGGCGATGAGGG + Intergenic
1125079712 15:35657986-35658008 GGGTGGGTGGAGAGGGATGCAGG - Intergenic
1126202065 15:45997781-45997803 TTGTGTGTGGAGAGGGATGGGGG - Intergenic
1126244117 15:46483799-46483821 TATGGTGTGCAGAGGGAAGATGG + Intergenic
1126759947 15:51960888-51960910 GAGTGTGGGGAGAGGGAAGGGGG + Intronic
1127448843 15:59096626-59096648 GTATGTGTGCAGATGGACGATGG + Exonic
1127651344 15:61011135-61011157 AAGTGTGTGCAGTTGAATGAGGG - Intronic
1129913479 15:79247300-79247322 GAGTGTGTGCTCAGGGAAGGAGG - Intergenic
1130556265 15:84924511-84924533 GAGTGTGGGGAAAGGGAGGAGGG - Intronic
1130844729 15:87734143-87734165 GAGTGGATGAAGAGGGATGGAGG + Intergenic
1131022107 15:89107628-89107650 GATGGTGTTCAGAGGGATTAAGG + Intronic
1131998373 15:98155243-98155265 GAGTGTCTGGAGAGGAAAGAGGG + Intergenic
1132214875 15:100055114-100055136 GAGTGTGGGCATAGGACTGAGGG - Intronic
1132298663 15:100763248-100763270 GAGGATGTGCAGAGGTTTGAAGG - Intergenic
1132839283 16:1971015-1971037 GAGTGGGTGCAGAGGGCAGAGGG - Intergenic
1132941847 16:2512423-2512445 GAGTGTGTGGAGAGGGTGGCAGG + Intronic
1133345363 16:5066088-5066110 GGGTGGCTGCAGGGGGATGACGG + Exonic
1133688480 16:8189789-8189811 GAGGCTGTGGAGAGGGATGGAGG - Intergenic
1134354122 16:13465207-13465229 GAGTTTGGGCAGAGGGCTGCTGG - Intergenic
1135063525 16:19290449-19290471 CAGTGTGTGCAGAGGTCTGGAGG - Intronic
1135325636 16:21523745-21523767 CAATGTGTGCAGAGGGAACACGG + Intergenic
1136035979 16:27540798-27540820 GAGTGTGTGCACAGGGATTAGGG + Intronic
1138389669 16:56661303-56661325 GATGGTGCGCAGAGGGAGGAAGG - Intronic
1139504568 16:67392532-67392554 GGGTGTGGCCAGAGGGCTGAGGG - Intronic
1140752414 16:78037503-78037525 GAGAGAATGGAGAGGGATGAAGG - Intronic
1141705504 16:85662321-85662343 GAGAGTGTGCAGAGGGGAGCAGG + Intronic
1141840940 16:86573664-86573686 GGGTGTGTGAAGAGGGAAGGGGG + Intergenic
1141851656 16:86650246-86650268 GAGTGTGTTCTGGGGGATGAAGG + Intergenic
1142023939 16:87802218-87802240 CAGTGTGTGCAGATGGCAGATGG - Intergenic
1142141886 16:88476222-88476244 GAGGCTGTGCAGAGGGATGGAGG - Intronic
1142323717 16:89400894-89400916 GGGTGTCTGCAGAGGGTGGAGGG - Intronic
1143250564 17:5520344-5520366 GAATGTGTGCAGAGGCATAGAGG - Intronic
1143720190 17:8803785-8803807 GAGTGTATGCAGAGGCATCTGGG + Intronic
1144186817 17:12804306-12804328 GAGGGGTTGCAGAGGGCTGATGG + Intronic
1144583748 17:16475314-16475336 GTGTGTGTGGAGAGAGAGGAAGG + Intronic
1146453301 17:32991371-32991393 TAGTGGGTGCACGGGGATGATGG - Intronic
1146689729 17:34865135-34865157 GAGTGATCGCAGAGGGAGGATGG - Intergenic
1146756728 17:35439135-35439157 GTTTGTGTGCACAGGGAGGAAGG + Exonic
1146793458 17:35765729-35765751 GTGTGTGTGCAGAGCTGTGATGG - Intronic
1147014863 17:37483522-37483544 GAGTGTGTGTTGAGGGGTGGGGG + Intergenic
1147540329 17:41351927-41351949 GGGTGTGGGTAGAGTGATGAAGG + Intergenic
1148682227 17:49481043-49481065 CAGAGTGGGCAGAGGGGTGAAGG + Intergenic
1148686173 17:49502396-49502418 GGAAGTGTGCAGAGGGAGGAGGG + Intronic
1151868992 17:76823902-76823924 GCGTGTGTGCAGAGGTGTGCAGG - Intergenic
1152261526 17:79269852-79269874 GAGAGTTTGCAGGTGGATGAGGG - Intronic
1152313949 17:79568920-79568942 GAGGATGTGCTGAGGGGTGATGG + Intergenic
1153930368 18:9873411-9873433 GTGGGTTTGCAGAAGGATGAGGG + Intergenic
1154079674 18:11243567-11243589 GGCTGTGAGCAGAGGGGTGACGG + Intergenic
1154087353 18:11320442-11320464 GAGTGTGGGCAGGGGAATAATGG - Intergenic
1155244837 18:23897465-23897487 GCGTGTGTGCAGAATGGTGAAGG - Intronic
1155311934 18:24532624-24532646 AAGTGACTGTAGAGGGATGAGGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156493161 18:37508332-37508354 GAGAGCGTGCAGAGGCAGGAGGG + Intronic
1156600837 18:38604174-38604196 GTGTCTGTGTAAAGGGATGAGGG + Intergenic
1157454035 18:47810333-47810355 GTGAGTGTGCAGTGGGAGGAGGG - Exonic
1157680726 18:49603363-49603385 GAGTGTGGCCAGAGGGCGGATGG - Intergenic
1159867166 18:73719834-73719856 GAGTTGGTGCAGGGGGAAGAAGG - Intergenic
1160223953 18:76998107-76998129 GAGGGTGTGGAGATGGATGGCGG - Intronic
1160281407 18:77494166-77494188 AAGTGAGTGAAGAAGGATGATGG + Intergenic
1160586920 18:79918135-79918157 GCGTGTGGGCAGAGGTGTGAGGG - Intronic
1161088895 19:2350045-2350067 GAGTGTGTGGAGAGAGAGAACGG - Intronic
1161088905 19:2350270-2350292 GAGTGTGTGGAGAGAGAGAACGG - Intronic
1161663640 19:5561955-5561977 AAGTGTATGGAGGGGGATGATGG + Intergenic
1161772055 19:6236242-6236264 CAGTGTCTGCAGAGCGCTGATGG + Intronic
1162015344 19:7843613-7843635 GTGTGTGTGAATAGGCATGAGGG + Intronic
1162430866 19:10627643-10627665 GGGTGTTTGCAGAGGGCAGATGG + Intronic
1163157785 19:15448946-15448968 GTGTGTGTGGAGGGGGGTGAAGG - Intronic
1163801443 19:19368155-19368177 CAGTGGGGGCAGAAGGATGATGG - Intergenic
1163860251 19:19739039-19739061 GAGTAGGGGCAGAGGGCTGAAGG - Intergenic
1165064494 19:33221078-33221100 GGCTTTGAGCAGAGGGATGATGG - Intronic
1165070782 19:33253809-33253831 GAGTGCCTGAAGAGGGATGGCGG - Intergenic
1165079790 19:33300719-33300741 GGGTGTGTGCGGAGGGAGGTGGG + Exonic
1165245589 19:34496718-34496740 GAGTGAGGGCAGGGGGAAGAGGG + Intronic
1166123777 19:40701504-40701526 GAGAGTGTGAAGTGGGGTGATGG - Intronic
1167037121 19:47001133-47001155 GGGTGTGTGCAGATGGAAGGTGG - Exonic
1167530768 19:50014805-50014827 AAGTATGAGCAGAGGAATGATGG + Intronic
1167650784 19:50727522-50727544 GAGAGAGTACAGAGAGATGAAGG - Intergenic
1167773828 19:51541901-51541923 GTGTGTGAGCAAAGGCATGAAGG - Intergenic
1168431310 19:56283198-56283220 GTGTGTGTGCAGTGGGAGCAGGG - Intronic
925222497 2:2153431-2153453 GTGTGTGTGCAGAGGGACTCTGG - Intronic
925363443 2:3295356-3295378 GAGGGTGTGTAGAGAGAGGATGG - Intronic
925363463 2:3295455-3295477 GAGGGTGTGTAGAGAGAGGATGG - Intronic
925363491 2:3295588-3295610 GAGGGTGTGCAGAGAGAGGAGGG - Intronic
925363510 2:3295688-3295710 GAGGGTGTGCAGAGAGAGGAGGG - Intronic
925363524 2:3295754-3295776 GTGTGTGTGCAGAGAGAGGACGG - Intronic
925363538 2:3295822-3295844 GTGTGTGTGCAGGGAGAGGATGG - Intronic
925363547 2:3295859-3295881 GGGTGTGTGCAGAGAGAGGATGG - Intronic
925363568 2:3295960-3295982 GTGTGTGTGCAGAGAGAGGATGG - Intronic
925363575 2:3295995-3296017 GAGGGTGTGTAGAGAGAGGATGG - Intronic
925363587 2:3296060-3296082 GTGTGTGTGCAGAGAGAGGAGGG - Intronic
925363655 2:3296375-3296397 GTGTGTGTGCAGAGAGAGGATGG - Intronic
925994627 2:9281993-9282015 GAGCATGAGCAGAGGGAAGAAGG - Intronic
926488643 2:13495864-13495886 GAGGGTGGGGAGTGGGATGAGGG + Intergenic
926523627 2:13949007-13949029 GATTGGGTGTAGAGAGATGATGG - Intergenic
926706280 2:15840063-15840085 TAGTGTGTGAGGAGGGGTGAAGG - Intergenic
927889852 2:26741503-26741525 GAGTGTGAGCACAGGGCTGATGG + Intergenic
928331313 2:30360025-30360047 GAGTGTGGACAGAGGGCAGAGGG + Intergenic
928590391 2:32808585-32808607 GTGTGTTTGCAGGGGCATGAAGG - Intronic
929678680 2:43966285-43966307 GTGTGAGTGAAAAGGGATGATGG + Intronic
932029457 2:68168457-68168479 GAGTGTGGGAAGAGGGAAGCTGG + Intronic
932029685 2:68170959-68170981 GAGTGTGTGCAGTGGAAGTAAGG - Intronic
932363643 2:71131020-71131042 GTCTGTGTGTAGAGGGATGGGGG - Intronic
932659523 2:73640308-73640330 GGGTCTCTGCAGAGGGAAGAAGG - Intergenic
932666087 2:73699979-73700001 GGGTCTCTGCAGAGGGAAGAAGG - Intergenic
932801896 2:74748250-74748272 GTGTGTGTCTAGAGGGATGGGGG - Intergenic
934524365 2:95042535-95042557 GGGTGGCTGCAGAGGGATAAGGG - Intronic
934544069 2:95199967-95199989 GGGTCTGTGCAGAGGGCTAAGGG + Intergenic
934687666 2:96333685-96333707 GTGTGTGTGCAGAGGCCTGGGGG + Intergenic
935227354 2:101064412-101064434 CAGTGTGTGGAGGGGGATGGAGG + Intronic
935494667 2:103765419-103765441 GTGTGTGGGCAGAAGGATGAGGG - Intergenic
937609905 2:123848394-123848416 GAATGTGTGTAGATGGAGGAAGG + Intergenic
937629046 2:124078796-124078818 GAGTGTCTGGAGAGGGATGCAGG + Intronic
938558325 2:132446820-132446842 GATTGTGGGGACAGGGATGAAGG + Intronic
938579782 2:132635598-132635620 CAGCGTGTGCAGAGGCATGGAGG + Intronic
939220823 2:139299543-139299565 GAGTGGGTGGAGACAGATGATGG - Intergenic
940154699 2:150643201-150643223 GTGTGTGTGCTGGGGGAGGATGG - Intergenic
940750818 2:157625596-157625618 GAGGGGGTGCAGAGGGGTGCAGG + Intronic
941408310 2:165120041-165120063 GTGGGTCTACAGAGGGATGATGG + Intronic
941574399 2:167212900-167212922 GTGTGTGTGCAGAGGGGTGGGGG - Intronic
942832244 2:180250961-180250983 GAGTCTGTGCAGAGGCACAAAGG - Intergenic
943370588 2:187010996-187011018 GGGTGTGTGCAGAGAGGGGAAGG - Intergenic
943745657 2:191460355-191460377 GTGTGTGTGTGGAGGGATGGTGG - Intergenic
943761252 2:191611888-191611910 AAGTGTGTGCACAGGGATGGCGG + Intergenic
944354015 2:198763569-198763591 GAGTGTGTGCAGAAGGGAGATGG - Intergenic
944648958 2:201809726-201809748 GAGTGTGTGCCGGGGAATGGAGG - Intronic
944778809 2:202996504-202996526 GAGTCTGTGCAGTGAAATGAAGG + Intronic
946037348 2:216754707-216754729 GTGGGTGGGCAGAGGGATGTAGG + Intergenic
947812983 2:233015823-233015845 GAGAGTGAGCAGAAGGATGAGGG - Exonic
1172083128 20:32358316-32358338 GTGTGTGTGAAGAGTGAGGAGGG - Intergenic
1172230850 20:33334499-33334521 GAGGGTGGGCAGATGGATGGTGG + Intergenic
1172321529 20:33998819-33998841 GAGTGTGTGCAGAAAAAAGATGG + Intronic
1172656999 20:36543453-36543475 GGGTTTGGGCAGAGGGAAGAGGG + Intronic
1172693048 20:36803642-36803664 GACTGTGAGCAGTGGGAAGAAGG + Intronic
1172969999 20:38866283-38866305 GTGTCTGTGCAGCGGGAAGAAGG + Intronic
1173336730 20:42118201-42118223 GAGGGTGTAAAAAGGGATGAAGG + Intronic
1174414662 20:50358854-50358876 GGGTGGGTGCAGAGGGCTGGTGG - Intergenic
1174421255 20:50400481-50400503 AAGTGAGTTCAGAGGGGTGAAGG + Intergenic
1174845698 20:53941120-53941142 GTGTGTGTGAAGTGGGAGGAGGG + Intronic
1174885098 20:54325140-54325162 GAGAGTGGGCAGAGGGAGGTAGG + Intergenic
1175175930 20:57112108-57112130 GGGTTTGTGCAGGGGCATGATGG + Intergenic
1175852533 20:62101521-62101543 GTGTGGGTGTAGGGGGATGAGGG + Intergenic
1176033099 20:63023319-63023341 AAGGGTGTGAAGAGGGAAGAGGG - Intergenic
1176972901 21:15287579-15287601 GAGTATGTGCTGTGGGATGGAGG - Intergenic
1177319146 21:19497630-19497652 GAGTGTGTGCTGGGCGAGGATGG - Intergenic
1177688019 21:24465483-24465505 GAGTGTGTGAAGAGCGAAGGGGG - Intergenic
1178634860 21:34293277-34293299 AAGCATGTGCAGAGGCATGAAGG - Intergenic
1178878231 21:36428889-36428911 GAGTGTGTGCTGAGGACAGACGG + Intergenic
1181041244 22:20193695-20193717 GGGAGGGTGCTGAGGGATGACGG - Intergenic
1181063201 22:20291832-20291854 GTGTGTGTGAAGAGGGAGGCAGG - Intergenic
1181150973 22:20883330-20883352 GAGGCTATCCAGAGGGATGAGGG - Intronic
1182060690 22:27395040-27395062 GTGAGTGAGCAGATGGATGAGGG + Intergenic
1184279393 22:43428394-43428416 CAGGGTGGGCACAGGGATGAGGG + Intronic
1184523526 22:45008916-45008938 GAGTGTGTGCCGGGGGAGGGGGG + Intronic
1185164402 22:49251912-49251934 GAGTGTGAGCTGAGGGAAGGAGG + Intergenic
1185181557 22:49366375-49366397 GAGAGTGTGCAGAGCGGTGCCGG + Intergenic
949244629 3:1912086-1912108 GATTGTGTGAAGAGGCTTGAAGG - Intergenic
949577587 3:5353536-5353558 GTGTGTGTGCACAGGGGAGAGGG + Intergenic
950204484 3:11068228-11068250 GAGTGGGTGCAGAGGTAAGGAGG - Intergenic
950449437 3:13057408-13057430 GAGTGTGTGTTGTGGGTTGAGGG - Intronic
950641202 3:14349603-14349625 GACTGTCTGCAGGGGCATGAGGG + Intergenic
950666947 3:14503489-14503511 GTGTGTGTGCAATGGGAGGAAGG - Intronic
950674911 3:14548859-14548881 GAGTCTGTGCAAAGGGCTCAAGG - Intergenic
951827969 3:26889577-26889599 GTGTGTGTGGTGAGGGTTGAGGG - Intergenic
952159398 3:30678586-30678608 AACTGTGTGCAGAAGGATGATGG + Intronic
952524837 3:34199197-34199219 GACTATGTGCAGAGGCCTGAAGG - Intergenic
952902739 3:38120758-38120780 CCCTGTGTGCAGAGAGATGAGGG + Intronic
953391350 3:42535699-42535721 CAGTGAGTGGGGAGGGATGAGGG + Intronic
953563591 3:44013104-44013126 GGATGTGTGCAGAGGTCTGAGGG + Intergenic
953878732 3:46680794-46680816 GAGTGTGTGCAAAGCCATGGAGG + Intronic
953903857 3:46858490-46858512 CCGTGCGTGCAGAGGCATGATGG + Intronic
954528419 3:51295277-51295299 CAGTGTGTGCAGAGATATCATGG + Intronic
954764114 3:52898275-52898297 GTGTGTGTGCAGGGGGATGTTGG - Intergenic
955473229 3:59308830-59308852 GAGAGTTTTCAGAAGGATGATGG + Intergenic
959173153 3:102868845-102868867 GAGTGTGTCAAGAGGTGTGATGG - Intergenic
959779219 3:110207988-110208010 GAGTGTGGGGGGTGGGATGAAGG + Intergenic
960006785 3:112789212-112789234 GAGAGTGTGTAGAGGTCTGAAGG - Intronic
960619327 3:119623660-119623682 GGGTGTGTGGAGAGGGAGCAGGG + Intronic
961197408 3:125014512-125014534 GAGTGTGTGTGGAGGGCTGGGGG + Intronic
961520437 3:127464602-127464624 GAGTGTGTGCCAAGGCAGGATGG + Intergenic
962114733 3:132491760-132491782 GAGTGTGTGCAGTCTGACGAGGG - Intronic
962276387 3:134017798-134017820 GGGTGTATGCAGAGGAATGGAGG - Intronic
962376545 3:134863101-134863123 CAGTGTGTGCACAGGCATGGGGG - Intronic
962384939 3:134925323-134925345 GAATGTGTGGAGAGGAAGGAGGG + Intronic
962642892 3:137406761-137406783 GAGTGAGTGTGGAGGGAGGAGGG + Intergenic
962940538 3:140121068-140121090 GAATGTGTGGACAGGGGTGAGGG + Intronic
962989235 3:140563488-140563510 GAGTGTGTGTAGAGGGCTCATGG - Intronic
963941463 3:151099871-151099893 GAGAGTGTGCAAAGAGATGGAGG + Intronic
964496221 3:157293176-157293198 GAGTGGGTGGAGAGGGAGGTAGG + Intronic
965538173 3:169846700-169846722 GAGGGTGTGTGGAGAGATGAGGG - Intronic
965969390 3:174535072-174535094 AAATGTGTGCAGATTGATGAAGG - Intronic
966039705 3:175467001-175467023 AACTGTGTGCAGTGTGATGATGG - Exonic
966049047 3:175590901-175590923 GTGTGTGTGCTTAGGGATGAAGG + Intronic
967670252 3:192225260-192225282 TATTGAGTGCAGAGCGATGATGG - Intronic
969203644 4:5625213-5625235 TGGAGTGTGCAGAGGGACGAGGG - Intronic
974188683 4:58474803-58474825 AAGTGGGGGCTGAGGGATGAGGG + Intergenic
974900003 4:67985054-67985076 GAGATTGTCCATAGGGATGATGG + Intergenic
975147062 4:70980143-70980165 GAGTGTGTACAGGGGGAAGATGG - Intronic
976710727 4:88068123-88068145 GAGTGAATTCAGAGAGATGAGGG - Intronic
977059763 4:92242586-92242608 GGATGTGTTCAAAGGGATGATGG + Intergenic
979666171 4:123313194-123313216 GAATGGATGCAGAGGGAGGAGGG - Intronic
980774664 4:137422365-137422387 GAGTATATGTAGAGGGGTGAAGG + Intergenic
984138308 4:175969805-175969827 AAGTGTGTGTGGAGGGATGCAGG + Intronic
985164840 4:187082359-187082381 GAGGATGTGGAGAGGAATGAAGG + Intergenic
985549528 5:525907-525929 GGGTGGGTGCAGATGGAGGATGG + Intergenic
985909738 5:2869498-2869520 GGATGTGTGCTGAGGGAAGATGG + Intergenic
986643625 5:9895147-9895169 GTGTGTGTGAAGGGGGGTGATGG + Intergenic
987047207 5:14119265-14119287 GAGTGTGTGCAGGTGGCTGTTGG - Intergenic
987525937 5:19050022-19050044 GATTGTGTGAAGAAGAATGAGGG - Intergenic
990257410 5:53985219-53985241 GAGTGTGAGCAGAGGGAGTGAGG - Intronic
990846313 5:60144036-60144058 GAGTGTTTGCAGAGTGACTAGGG - Intronic
991017103 5:61944016-61944038 GACTGTGTGCCCAGGGATGCTGG - Intergenic
991385026 5:66077747-66077769 GTGTGTGTGTAGAGGGAGGGAGG - Intronic
991720452 5:69490880-69490902 TAGTGGTTGCCGAGGGATGAGGG + Intergenic
993584670 5:89709382-89709404 GAATGTGTCCAGAGAGATAAAGG + Intergenic
994023638 5:95056852-95056874 GTGTGTGTGTATTGGGATGAAGG - Intronic
994957069 5:106545842-106545864 TAGGGTGTGCTGTGGGATGAAGG + Intergenic
995419284 5:111945095-111945117 GAGTGCGTGAAGAGGGGTTAGGG - Intronic
995597067 5:113759088-113759110 GAGTGAGTGAGGAGGCATGAGGG + Intergenic
996003528 5:118392452-118392474 GACTTTGTGAAGAGGGAAGATGG - Intergenic
996803897 5:127433378-127433400 GCGTGTGTGCTGAGGGACGCTGG + Exonic
997242043 5:132314854-132314876 CAGTGTCTGCAGAGGGGAGAAGG + Intronic
997724699 5:136110719-136110741 GAGTGTAAGCAGAGAGCTGATGG + Intergenic
997901821 5:137773879-137773901 GAATCTCTGCAGAGGGATGGTGG - Intergenic
998170340 5:139868860-139868882 GGGTAGGGGCAGAGGGATGAGGG + Intronic
998390777 5:141785815-141785837 GAATGAGTGGGGAGGGATGATGG - Intergenic
998823124 5:146074758-146074780 GAGAGAGGGCAGAGGGCTGAAGG - Intronic
1000041250 5:157486682-157486704 GAGTGCCAGCAGAGGGAGGAGGG - Intronic
1000139606 5:158389400-158389422 GAGGGCGTGGAGTGGGATGAAGG - Intergenic
1000951248 5:167485930-167485952 GTGTGTGTGCACATAGATGAAGG - Intronic
1001075823 5:168627360-168627382 GAGTATGTGCAGCAGGATGTAGG + Intergenic
1001084188 5:168688413-168688435 GAGAGGGAGGAGAGGGATGAGGG - Intronic
1001536708 5:172503177-172503199 CAGTGTGAGCAGAGGGATCCAGG + Intergenic
1001626754 5:173142720-173142742 GAGGGTGTGTAGAGGGCTGTAGG + Intergenic
1001708757 5:173761231-173761253 GAGGGGGTGCCTAGGGATGAGGG - Intergenic
1001855982 5:175011270-175011292 CAGAGTGTGCACAGGGATGTTGG + Intergenic
1001888924 5:175322621-175322643 AACTGTGTGCAGAGGCCTGAGGG + Intergenic
1001930852 5:175672054-175672076 GTGTGTGTGTGGAGGGGTGAAGG - Intronic
1003387168 6:5679502-5679524 GAGTGTTGACAGAGGGGTGATGG - Intronic
1003499927 6:6695559-6695581 GAGTGTGGGCTGAGGGATGGTGG + Intergenic
1004902140 6:20204675-20204697 GTGTGTGTGCAGAGGCTGGAGGG + Intronic
1005423763 6:25679488-25679510 GTGTGTGTGCAGGGGATTGAAGG + Intronic
1005481597 6:26260145-26260167 GAGTATGTGCAAGGGGGTGAAGG + Intergenic
1005582190 6:27245978-27246000 GAGTGAGTGGGGAGGGAGGAAGG - Intergenic
1005959204 6:30684255-30684277 GTGTATGTGCAGAGCGAGGAAGG + Intronic
1006442175 6:34059574-34059596 CAGCATGTGCAGAGGGGTGAGGG - Intronic
1006938843 6:37738022-37738044 GAGTGAGTACAGGGAGATGAGGG + Intergenic
1007075031 6:39060856-39060878 GAGTGTGTGCATTGGGGAGAAGG + Intronic
1007210877 6:40192607-40192629 GAAGGTGTGGAGAGGGATCATGG + Intergenic
1007373954 6:41443753-41443775 GAGTGTGTGCGAGGGGATGGGGG + Intergenic
1007742530 6:44021645-44021667 GAGGGTGTGCAGAGGGATTAGGG + Intergenic
1008042974 6:46821472-46821494 GTGTGTGTGTAGAAGGAAGAAGG + Intronic
1008688055 6:53945968-53945990 GTGTGTATGCAGTGGGGTGAGGG + Intronic
1008927562 6:56902913-56902935 GTGTGTGTGTAGAGGGTGGAGGG - Intronic
1010680399 6:78792470-78792492 GAGTGTGGACAGTGGGAGGAGGG + Intergenic
1011203986 6:84871943-84871965 GTGTGTGTGCGGAGGGTGGAGGG + Intergenic
1011307149 6:85940550-85940572 GAGGGTCTGGAGAGGAATGAGGG - Intergenic
1011780816 6:90787377-90787399 AAATGTGTGCAGAGGGTAGAAGG + Intergenic
1014713145 6:124832801-124832823 GAGTGTGTGAGGTGGGTTGAAGG - Intergenic
1015407864 6:132857538-132857560 GGTTTTGTGCAAAGGGATGAGGG + Intergenic
1015465342 6:133542806-133542828 GTGTGTGTGCAGAGGAAGGAGGG + Intergenic
1016156771 6:140820428-140820450 GAGGGTGTGCACAGGCATGCTGG + Intergenic
1016705223 6:147099309-147099331 GTGTGTGTGCAGAAGGAAGATGG - Intergenic
1017021884 6:150146651-150146673 TGGTGTGTGCAGAGGCATCATGG - Intronic
1017062116 6:150493564-150493586 GTGTGTGTGTAGAGGGGAGAGGG + Intergenic
1017884569 6:158588323-158588345 GGGAGTGTGCAGGGGGCTGAAGG - Intronic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1018051927 6:160016650-160016672 CAGGGTGTGGTGAGGGATGATGG - Intronic
1019479416 7:1259749-1259771 GAGTGTGAGCAGAGGGAGGGTGG + Intergenic
1019609012 7:1927059-1927081 GCGTGTGTGTAGATGTATGACGG - Intronic
1019873393 7:3788398-3788420 GAGTCTGTGCAGAGGGGATAAGG + Intronic
1019896046 7:3984187-3984209 GAGAGGGGGCAGAGGGATGGAGG + Intronic
1021184207 7:17543905-17543927 GAGAAAGTGCAGAGGGATGAAGG + Intergenic
1022614464 7:31915080-31915102 GATTGGTTCCAGAGGGATGATGG - Intronic
1023664970 7:42513404-42513426 GTGTGTGTGGAGTGGGATGCAGG + Intergenic
1023817219 7:43960303-43960325 GACTGGGGGCAGAGGGATGAGGG + Intergenic
1023878793 7:44307119-44307141 GGGTGTGAGCAGGGGGAGGAGGG + Intronic
1023878798 7:44307139-44307161 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878803 7:44307159-44307181 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878806 7:44307179-44307201 GGGTGTGAGCAGAGAGAGGAGGG + Intronic
1023878820 7:44307236-44307258 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878830 7:44307276-44307298 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023967611 7:44971028-44971050 GAGTTTGTGGAGACGGAGGAGGG - Exonic
1024391413 7:48816947-48816969 GAGTGGGGACAGAGGGATGAAGG + Intergenic
1025049588 7:55723128-55723150 GAATGTGTGCAGAGGGAGGTGGG - Intergenic
1026396734 7:69962940-69962962 GAGAGTCTGAAGAGGTATGATGG - Intronic
1026984442 7:74546100-74546122 GGGTGAGGGCGGAGGGATGAGGG - Intronic
1029619763 7:101682838-101682860 ATGTGTGAGCATAGGGATGATGG - Intergenic
1030014619 7:105206205-105206227 GTGTGTGTGCTGGGGGAGGAGGG + Intronic
1030496569 7:110308018-110308040 GAGTGTGTGAGGAGGGAGGCTGG + Intergenic
1030668622 7:112309514-112309536 GAGGGTGTGCTTTGGGATGAGGG + Intronic
1030979841 7:116173599-116173621 GAGGGTGTTGAGAGGGAAGATGG - Intergenic
1032007067 7:128311124-128311146 GAGTGAGTGCACAGGGAGCAGGG + Intronic
1033792620 7:144809533-144809555 GTGTATGAGCAGAGAGATGATGG - Intronic
1034329192 7:150268461-150268483 GAGTGTATTCAGAGGGCGGAAGG - Intronic
1034668862 7:152841399-152841421 GAGTGTATTCAGAGGGCGGAAGG + Intronic
1034911248 7:155000804-155000826 GCGTATGTGCTGAGGAATGAAGG - Intronic
1036206032 8:6806304-6806326 GAGTGAGTGCGGGGGGATGGAGG + Intergenic
1036792854 8:11734430-11734452 GAGTGGATGCAGTGAGATGATGG - Intronic
1036848541 8:12185974-12185996 GAGTGTGCTCACAGGGGTGAGGG + Intronic
1036869901 8:12428255-12428277 GAGTGTGCTCACAGGGGTGAGGG + Intronic
1037415538 8:18645931-18645953 GAGTGTGTGCAGAGAGAGGTAGG - Intronic
1038248060 8:25877669-25877691 GAGTGTGTGCAGTGGGACAGGGG + Intronic
1038669950 8:29574873-29574895 GACTGGGGGCAGAGAGATGAGGG + Intergenic
1039040510 8:33403615-33403637 GAGAGTGTGAGGTGGGATGATGG + Intronic
1039133076 8:34289945-34289967 GGGTGAGTGCAGAGGGAGGGAGG + Intergenic
1039424597 8:37475716-37475738 GACTGTGTGCAGGAGGATGGAGG + Intergenic
1039620101 8:38989066-38989088 GTTTGTGGGCAGATGGATGATGG + Exonic
1041110222 8:54476602-54476624 GAGTGAGTGGAGCGGGATGTAGG - Intergenic
1042014903 8:64298159-64298181 GAGTGTGCGAATATGGATGAAGG + Intergenic
1042518179 8:69681767-69681789 GAGTCTGTGAAGATGGGTGATGG - Intronic
1043394243 8:79821462-79821484 GGCTGTGTGCAGAGCTATGATGG - Intergenic
1044108438 8:88240451-88240473 GACAGAGTGGAGAGGGATGAAGG + Intronic
1044475404 8:92619319-92619341 GGGTGACTGCAGAGGGATGGTGG - Intergenic
1045040914 8:98223332-98223354 GAATGTGTGTAGGGGGATTAGGG + Intronic
1045252483 8:100493459-100493481 GTGGGTGTGAAGAGGGAGGAGGG + Intergenic
1045327546 8:101127799-101127821 GTGTGGGAGCAGAGGGATGGGGG + Intergenic
1045553157 8:103190756-103190778 GAGTGTCTGCAGGGTGAAGATGG + Intronic
1046850133 8:118962778-118962800 TAGTGTTTGCTGAGGGCTGAGGG - Intergenic
1047205914 8:122802928-122802950 GAGTGGGGGCAGTGGGATGCAGG - Intronic
1047975681 8:130127822-130127844 GAGTGTGTCCATAGGGGTTAAGG + Intronic
1048048702 8:130796939-130796961 GGGTGTTTGCAGAGGGAAGTTGG - Intronic
1049521248 8:143092520-143092542 GAATGTGTGCTCAGGGTTGAGGG + Intergenic
1049706213 8:144044051-144044073 GAGTGAGTGCAGGGGGAAGGTGG - Intronic
1051086183 9:13351296-13351318 GACTTTGTACAGAGGAATGAGGG + Intergenic
1052938080 9:34110107-34110129 GAGTGGGAGCAGGGGGAAGAAGG + Intronic
1052959289 9:34280851-34280873 GGGTGTGTGCAGTGGCATGGTGG - Intronic
1053071379 9:35104060-35104082 GAGGGTGTGAAGGGGGATGGAGG - Intergenic
1053089346 9:35259777-35259799 GTGTGTGTGTAGGGGGATGCGGG + Intronic
1053395292 9:37768190-37768212 GAGTGTGTGAGGATGAATGATGG + Exonic
1055296752 9:74841095-74841117 AAGTGTTTTCAGAGGGATAATGG - Intronic
1055934132 9:81589298-81589320 GAGAGAGGGCAGAGGGATGGGGG - Intronic
1056331160 9:85522462-85522484 GTGTGTGTCCAGAGGGCTGGTGG - Intergenic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1056779515 9:89538858-89538880 CAGTGTGTGCAGTGGGGTGATGG + Intergenic
1057499736 9:95587246-95587268 GAGGTTGTGCAGCCGGATGATGG - Intergenic
1058485725 9:105441862-105441884 GAGTATATGCAGAGGGATAGGGG + Intergenic
1058910530 9:109516524-109516546 GGGTGTGTGTAGGGGGATGGTGG + Intergenic
1059438904 9:114291792-114291814 GAGTGTGAGCTGAGGTTTGAAGG + Intronic
1059450737 9:114370257-114370279 GAGTCTGAGCAGATGGCTGAGGG - Intronic
1060200474 9:121649392-121649414 GAGTGTGTGTGGAGGGGAGAGGG - Intronic
1060456662 9:123804951-123804973 AAGTGAGTGCAGAGGTATGCTGG - Intronic
1060549924 9:124480063-124480085 CAGTGTGAGCAGAAGGATGGAGG - Intergenic
1060799047 9:126532208-126532230 GAGTGGCTTCAGAGGTATGAAGG - Intergenic
1060917094 9:127397838-127397860 GAGTGGGTGGAGGGGGAGGATGG + Intronic
1061007464 9:127936306-127936328 AGGTGTGAGCAGAGTGATGATGG + Intronic
1061137317 9:128742397-128742419 GAGAGTGTGCTGAAGCATGAGGG - Intronic
1061718710 9:132538015-132538037 GGGTGTGTGCAGAGGTTTGGTGG - Intronic
1062060609 9:134493358-134493380 GAGAGTGTGGGGTGGGATGAAGG + Intergenic
1203742538 Un_GL000218v1:14717-14739 GAATGTGGGCAGAGGGTAGAGGG + Intergenic
1186483403 X:9913547-9913569 TTGTGTGTGCAGAGGGTCGATGG + Intronic
1186641779 X:11463243-11463265 GGGCGTGTGGAGAGGGAGGATGG + Intronic
1186659193 X:11651280-11651302 GAGGGTGAGCAGTGGGAGGAGGG - Intronic
1186688623 X:11951591-11951613 GAGGGTGAGCAGTGGGAGGAGGG + Intergenic
1186855467 X:13621946-13621968 GAGTGTGTAAATTGGGATGATGG - Intronic
1187361638 X:18633619-18633641 GCGTGTATGCAGATAGATGAGGG - Intronic
1189158980 X:38791134-38791156 GAATGTGAGCAGAGAGAAGATGG - Intergenic
1189711291 X:43815040-43815062 GGGTGTGTTCAGAAGGATGCAGG + Intronic
1190008025 X:46758781-46758803 GAGCGTGAGCAGCAGGATGAAGG + Exonic
1190454760 X:50616860-50616882 GTGTGTGTGGTGAGGGATGGGGG - Intronic
1191849018 X:65571896-65571918 GATTCTGAGCAGAGGGAGGAAGG + Intergenic
1192256829 X:69468544-69468566 GAGTGTGAGCAGTGGGGCGAGGG + Intergenic
1192537226 X:71938537-71938559 GATTTTGTGCAGAGTGGTGAAGG + Intergenic
1193787770 X:85781396-85781418 GAATGAGTGCTGAGTGATGAGGG - Intergenic
1194329831 X:92568058-92568080 TAGTTTGTGCACAGAGATGATGG + Intronic
1196172979 X:112610247-112610269 GAGTGTGTGCATAGGGGCCAGGG - Intergenic
1196279800 X:113810741-113810763 GAGTGTGTGAAGTGGGAAGCAGG + Intergenic
1196533928 X:116818334-116818356 AAGTGTTTTCAGAGGGATAATGG + Intergenic
1197354690 X:125423515-125423537 TAGTGTTTGCAGAGGGCTGGGGG + Intergenic
1198496117 X:137195282-137195304 GTGTGTGTGTATACGGATGAGGG + Intergenic
1199109710 X:143916372-143916394 GAGTATGTATAGAGGGGTGAGGG - Intergenic
1200066024 X:153504452-153504474 GAGTGTGGGCAGAGGGCTCCAGG - Intronic
1200638535 Y:5687240-5687262 TAGTTTGTGCACAGAGATGATGG + Intronic