ID: 906101897

View in Genome Browser
Species Human (GRCh38)
Location 1:43269319-43269341
Sequence CTGTGTAAGGGGCCCATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906101897_906101903 -4 Left 906101897 1:43269319-43269341 CCCTCCATGGGCCCCTTACACAG 0: 1
1: 0
2: 3
3: 11
4: 155
Right 906101903 1:43269338-43269360 ACAGCCCAAGTGCCTCACTATGG 0: 1
1: 0
2: 0
3: 8
4: 103
906101897_906101904 -3 Left 906101897 1:43269319-43269341 CCCTCCATGGGCCCCTTACACAG 0: 1
1: 0
2: 3
3: 11
4: 155
Right 906101904 1:43269339-43269361 CAGCCCAAGTGCCTCACTATGGG 0: 1
1: 0
2: 0
3: 9
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906101897 Original CRISPR CTGTGTAAGGGGCCCATGGA GGG (reversed) Intronic
901716379 1:11157969-11157991 CAGTGTCAGGGGCCAAAGGAGGG + Intronic
902622968 1:17661045-17661067 CTGAGTAGAGGGCCCATGGTGGG - Intronic
906101897 1:43269319-43269341 CTGTGTAAGGGGCCCATGGAGGG - Intronic
906126808 1:43431945-43431967 CTGTGCCTGGGGCCCAGGGAAGG - Intronic
906516503 1:46442241-46442263 CTGTGCATGGGACCCAGGGATGG - Intergenic
911381471 1:97120375-97120397 CTGTCTAGGTGGCCCATGGGTGG - Intronic
912491157 1:110063566-110063588 CTCTGGAAGGGCCCCATGCAGGG + Intronic
913569628 1:120107273-120107295 CTGCCTATGGGGCCTATGGAAGG + Intergenic
913612208 1:120519411-120519433 CTGTGAAAGGGGCCAATACAGGG + Intergenic
914290437 1:146268235-146268257 CTGCCTATGGGGCCTATGGAAGG + Intergenic
914551481 1:148719018-148719040 CTGCCTATGGGGCCTATGGAAGG + Intergenic
914578981 1:149002827-149002849 CTGTGAAAGGGGCCAATACAGGG - Intronic
914742084 1:150473137-150473159 CTGTGTGAGGGACCCAAGGGGGG - Exonic
914912623 1:151799948-151799970 CTATGTAGGGGTCCCCTGGAAGG + Intergenic
915567383 1:156723147-156723169 CTGGTTAAGTGTCCCATGGAAGG - Exonic
917589739 1:176463773-176463795 CTGTGCAGGGAGACCATGGAGGG + Intronic
921081096 1:211738863-211738885 CTGTGGCAGGAGCCCCTGGAAGG + Intergenic
924020260 1:239773665-239773687 AAGTGTGAGGGGCCAATGGAAGG - Intronic
924637173 1:245799191-245799213 CTGTGTAGGAGGACCAGGGAAGG - Intronic
1062907957 10:1191399-1191421 CTGTGTAGGAAGCCCAAGGAAGG + Intronic
1063092018 10:2873706-2873728 CTGTCAAAGGGGTCCATGCATGG + Intergenic
1063691965 10:8296029-8296051 ATGTGGGAGGGGGCCATGGAAGG - Intergenic
1065195859 10:23264882-23264904 CTGGGTGAGGGGCCCAAGGCTGG - Intergenic
1066321166 10:34305367-34305389 GTCTGTAAGTGGCCCATGGCTGG + Intronic
1070014485 10:72512395-72512417 CTGTGTATGGGGGCCAGGCATGG - Intronic
1070829927 10:79411932-79411954 CTCTGTAAGGGGCACATGTGGGG - Intronic
1071489589 10:86127259-86127281 CAGTGTAAGAGGTCCAGGGATGG + Intronic
1074123715 10:110511978-110512000 CTGGGTAAGTGGCCAAGGGATGG + Intergenic
1074318006 10:112376445-112376467 CAGGGTAAGGGGACCATCGAGGG + Exonic
1076596689 10:131626605-131626627 GAGTGGAAGGGGCCCATGGGAGG + Intergenic
1077364148 11:2154783-2154805 ATGTGTAACGGGCCCATGCCAGG + Intronic
1078557387 11:12341023-12341045 CTGTGTAAGGAGCCTGTGGGAGG + Intronic
1079077611 11:17393678-17393700 CGCGGTAAGGGGCCCATTGATGG - Exonic
1081745515 11:45469998-45470020 GGGTGTATGGGGCCCATGGCAGG + Intergenic
1083591653 11:63898909-63898931 GTCTGTAAGTGGCCCTTGGAGGG + Intronic
1085081037 11:73634479-73634501 CTGTGTAAAAGGGCCATGCATGG + Intergenic
1086840186 11:91675477-91675499 CTGTGGGAGGGACCCATGGTTGG + Intergenic
1088863090 11:113820649-113820671 CTGGTTAAGTGTCCCATGGAAGG - Intronic
1089121534 11:116138989-116139011 CTGAGGAAGATGCCCATGGATGG - Intergenic
1089255827 11:117193447-117193469 CTGTTTCAAGGGCCCTTGGAAGG - Intronic
1095893577 12:47258196-47258218 CAGAACAAGGGGCCCATGGAGGG + Intergenic
1097694852 12:62766061-62766083 CCGTGTAAGGGGCCCAGGTGAGG + Intronic
1098661823 12:73103963-73103985 CTGAGTAAGTGGCCTTTGGATGG - Intergenic
1104209963 12:126679224-126679246 CTGGGAAAGAGGCACATGGATGG - Intergenic
1104584041 12:130033326-130033348 CTGTCTAAGGGGCTCTTGGATGG + Intergenic
1105730126 13:23205440-23205462 CTGGGTAGGAGGCCCATGGAAGG + Intronic
1106111956 13:26785390-26785412 CTGGGTCAGGTGCCCATGGCCGG + Intergenic
1106396267 13:29383849-29383871 CTATGTAAGTGGCCTGTGGATGG - Intronic
1116100328 14:40425565-40425587 TTGTGGAAGGGACCCATGGGAGG - Intergenic
1116217065 14:42030304-42030326 CTGTGTGATGGGCTTATGGAAGG - Intergenic
1121692324 14:95886662-95886684 CTGTAAATGGGACCCATGGAGGG - Intergenic
1122101207 14:99411397-99411419 GTGTGTGAGGTGCCAATGGATGG + Intronic
1122246584 14:100407489-100407511 TTGTGTGTGGGGCTCATGGATGG + Intronic
1122425395 14:101602537-101602559 CTGGGGAGGGGCCCCATGGAGGG + Intergenic
1125754433 15:42053287-42053309 CTGTGTGTGGGGCCCAGGCAGGG + Intergenic
1126004468 15:44243178-44243200 ATGTGTAGGAGGCCGATGGAGGG - Intergenic
1127723718 15:61727199-61727221 CTGTGTAAGGCTGCCATGGACGG - Intergenic
1128385735 15:67147001-67147023 CTGTGGGAGGGGCCCCTGGCAGG - Intronic
1131709736 15:95039760-95039782 CATTGCAAGGGGCCCAAGGAAGG + Intergenic
1133192939 16:4147652-4147674 CTGTGGAAGGGGCCCATGAATGG - Intergenic
1134241403 16:12509526-12509548 CTGTCTTTGGGTCCCATGGAGGG + Intronic
1134453232 16:14376162-14376184 CTGTGTGAGGGGCACAGGGCAGG + Intergenic
1135354236 16:21756325-21756347 CTCTGTGAGGGCTCCATGGAGGG - Intronic
1135452728 16:22572466-22572488 CTCTGTGAGGGCTCCATGGAGGG - Intergenic
1141569095 16:84923329-84923351 CTGTGGATGGGGCCCAGGAATGG - Intergenic
1141900743 16:86988730-86988752 ATGTGTGAGGGGCCCAGGGAAGG + Intergenic
1142295795 16:89221209-89221231 GTGTGTATCAGGCCCATGGACGG + Intronic
1144057400 17:11555212-11555234 CTGTGGAAGGATGCCATGGACGG + Intronic
1144821283 17:18076494-18076516 CTGGGCAAGGGGCCCTTGCATGG - Intergenic
1145815251 17:27790522-27790544 CTGGGTGAAGGGCCCATGGAAGG - Intronic
1150740214 17:67773293-67773315 TTTTGAAAGGGGCTCATGGAGGG + Intergenic
1151235058 17:72713876-72713898 CTGTATAATGGGCCTATGAATGG - Intronic
1152195574 17:78916357-78916379 TTGTGTAACGGGGCCTTGGAGGG - Intronic
1152240285 17:79157355-79157377 CTGTGGAAGGGGTGCATGGACGG - Intronic
1152648859 17:81482752-81482774 TGGTGTTAGTGGCCCATGGAAGG + Intergenic
1158911947 18:62073199-62073221 GTGTGTAAGGGGGGGATGGAGGG + Intronic
1163667414 19:18609900-18609922 ATGTGTAAGGGGCAGAAGGAGGG + Intronic
1163799393 19:19355614-19355636 CTGTGTGAGCAGCCCAAGGAAGG + Intronic
1164576759 19:29409604-29409626 CTGTACATGTGGCCCATGGAGGG + Intergenic
1164638893 19:29811225-29811247 ATATGGAAGGGGCGCATGGAAGG + Intergenic
1167407664 19:49324509-49324531 CGGTGTAGGGGCACCATGGAGGG - Intronic
925403802 2:3592233-3592255 CCGTGGAAGGAGACCATGGAGGG + Intergenic
925880292 2:8346303-8346325 CTGTTTATAGGGCCTATGGAAGG + Intergenic
927996645 2:27491809-27491831 TGGTGTAAGGGGCCCTTGGAGGG + Intergenic
930975900 2:57460681-57460703 ATGTGTAAGGGTCCCAGGGCAGG - Intergenic
932272007 2:70419120-70419142 CTGTGTGAAGAGCCCAGGGAAGG + Intergenic
932448921 2:71797352-71797374 CTGAGTATGGGGCCCATAGAGGG + Intergenic
935443001 2:103123595-103123617 CTCTGGAAATGGCCCATGGAGGG - Intergenic
936378884 2:111966930-111966952 CTGTGGATGAGGCCCAGGGAGGG - Intronic
936657278 2:114503014-114503036 AAGTATAAAGGGCCCATGGAGGG + Intronic
936816315 2:116465188-116465210 CTGTGTAGAGAGTCCATGGAGGG + Intergenic
937212728 2:120286747-120286769 CTGTGACAGGGGACAATGGAGGG - Intronic
938243824 2:129762569-129762591 CTGTGTGTGAGGCCCACGGAAGG - Intergenic
942239454 2:173946227-173946249 CTGGGAAAGGGGTACATGGAAGG + Intronic
943081186 2:183260867-183260889 CAGAGTAAGCTGCCCATGGAAGG + Intergenic
947909705 2:233792953-233792975 CTGGGTAAGGAGCAGATGGAGGG + Intronic
949032328 2:241802951-241802973 CTGTGCCAGGGGCCCGTGGAGGG + Intronic
1168867967 20:1105292-1105314 GTGTGTCAGGAGCCCAGGGAGGG - Intergenic
1169152577 20:3301579-3301601 CTGTGTAAGTGGCCCAAGAGGGG - Intronic
1170212329 20:13857915-13857937 ATGGGTGAGGGGCCCAGGGATGG + Intronic
1172271914 20:33659733-33659755 CTGTGTGTGGGGCCCGTGCAGGG + Intronic
1172798054 20:37556865-37556887 CTGTGTGAGGGCCCCAGGGTGGG - Intergenic
1173825272 20:46044025-46044047 CTGTGTGAGGGGCCTGTGGGAGG + Intronic
1174452999 20:50631199-50631221 CTGTGTTAGGTGCTCAGGGAGGG - Intronic
1175970264 20:62682808-62682830 CTGTGAATGGGGCCCATACAGGG + Intronic
1178219914 21:30644594-30644616 CTGTGTAAGCAGCCAATGCAAGG + Intergenic
1178916866 21:36709664-36709686 GTGTGCAAGGGGCGCAAGGACGG + Intronic
1179765952 21:43573293-43573315 CTGTGTGGTGGGCCCATGGCGGG + Intronic
1180253083 21:46602599-46602621 CTGTCTAAGAGGCCGGTGGAAGG - Intronic
1182867172 22:33613876-33613898 CTGTGTAAGGGGCCAGGAGAGGG - Intronic
1183688355 22:39374798-39374820 TAGTCTAAGGGACCCATGGATGG + Intronic
950674909 3:14548855-14548877 CTGTGCAAAGGGCTCAAGGAGGG - Intergenic
950968809 3:17166267-17166289 CTGTGGCAGGGGTCCATAGAGGG - Intronic
952577256 3:34790262-34790284 GTTTTTAAAGGGCCCATGGATGG - Intergenic
952895192 3:38074026-38074048 CTGTGTAAGGACCCACTGGAAGG - Intronic
953258452 3:41312857-41312879 CAGTGTAAGTGGCCCCAGGAGGG + Intronic
954785825 3:53091812-53091834 CTGTGTAAGAGCCCCACTGAGGG - Exonic
955812274 3:62803903-62803925 CTGTGCAAAGGCCCCACGGAGGG - Intronic
956160545 3:66346858-66346880 CTGTGTAAGGACCACTTGGATGG + Intronic
961328474 3:126125460-126125482 CTGAGAGTGGGGCCCATGGAGGG + Intronic
969686805 4:8680035-8680057 TGGTGTAAGGGGCACAAGGAAGG + Intergenic
970146341 4:13040255-13040277 CTTTTAAAGGGGGCCATGGATGG + Intergenic
973201662 4:47510324-47510346 CTCTAGAAGGGGGCCATGGAGGG + Intronic
976583746 4:86770850-86770872 CTGTATAATGGTCCAATGGATGG - Intronic
979770169 4:124514434-124514456 CTGTGTAACAAGCCCATGGTAGG + Intergenic
981422784 4:144570560-144570582 CTGGGGAAGGGGTGCATGGATGG + Intergenic
988173687 5:27692930-27692952 CTGAATAAGAGGCCCATGTATGG - Intergenic
989257699 5:39382946-39382968 CTGAGTAATGGGCCCCTGAATGG - Exonic
998152782 5:139766487-139766509 CTGTGTATGGGGGAAATGGATGG + Intergenic
1001485593 5:172117462-172117484 CTGGGTAAGGGGCTCAGGGTGGG - Exonic
1002304618 5:178275869-178275891 GTGTTTAAGGGGATCATGGAGGG - Intronic
1008008679 6:46439911-46439933 CTTTGCAAGGGGCACATGAAAGG - Intronic
1011018125 6:82781599-82781621 CTGGGTAGTGGGTCCATGGAGGG - Intergenic
1013314135 6:108924823-108924845 CTGTGGAAGGAGCCCATCCAGGG + Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1018785459 6:167104553-167104575 CTCTGCAAAGGCCCCATGGAGGG - Intergenic
1019510363 7:1414613-1414635 CTTTGCAACGGGACCATGGAAGG - Intergenic
1019516814 7:1443837-1443859 CTGTGTAAGCCGCCCAGTGAGGG + Intronic
1019696706 7:2450388-2450410 CAGTGGAAGGGGCCCCTGCAGGG + Intergenic
1024912943 7:54466805-54466827 CAGTCTCTGGGGCCCATGGATGG + Intergenic
1026953985 7:74365376-74365398 CTGAGTAAGGGGCACATGGATGG - Intronic
1029194754 7:98797428-98797450 CTGTGTCAGAGGCCGACGGAGGG + Intergenic
1029911795 7:104159606-104159628 CTGTGTGAGGGGCACAGTGAAGG - Intronic
1031262741 7:119543033-119543055 CTGTAGAAGAAGCCCATGGATGG + Intergenic
1031690867 7:124786144-124786166 CTGTGGGAGGGACCCATGGGAGG + Intronic
1031738479 7:125397411-125397433 CAATGGAAGGGGCCCATGGCTGG + Intergenic
1033277590 7:139984361-139984383 ATGTGGAAGGGACACATGGAAGG - Intronic
1034552907 7:151832617-151832639 CTGTGGAAGGGACCCAGGGTGGG - Intronic
1035377670 7:158416147-158416169 CAGTGCATGGGGCCCAGGGAAGG - Intronic
1035433133 7:158837389-158837411 CTGTGGAGGGGCCACATGGAAGG - Intergenic
1037902044 8:22694154-22694176 CCGGGTCAGGGGCCCAGGGAGGG - Intergenic
1038026452 8:23595281-23595303 CTGTCTAAGGGTCCCAAGGGTGG + Intergenic
1038898255 8:31812258-31812280 CTGTATGAGGGTCCCTTGGAGGG + Intronic
1046404677 8:113757459-113757481 TTGTGGGAGGGGCCCAGGGAAGG + Intergenic
1048454794 8:134567921-134567943 GTGTGTAGGGGGCCTATGGAGGG - Intronic
1048893825 8:138970878-138970900 GTTTTTAAGGGGACCATGGAGGG + Intergenic
1049573485 8:143380172-143380194 CTTGGTAAGGCGCCCATGGGTGG + Exonic
1051605634 9:18915433-18915455 CTGTGGAAGGGGCCAAATGAGGG - Intergenic
1052805823 9:33012402-33012424 ATGTGGAAGGGGACTATGGAAGG - Intronic
1057417182 9:94874960-94874982 CTGTGTAAGGGGCTCAAGGATGG + Intronic
1060693391 9:125684977-125684999 CAGTGAAATGGGCACATGGAGGG - Intronic
1061290436 9:129647676-129647698 GTGAGTGAGGGGCCCAGGGAGGG + Intergenic
1061618179 9:131793866-131793888 GTGTGTGAGGTGGCCATGGATGG + Intergenic
1062149879 9:135012418-135012440 CTGTGTGTGGGGCCCAGGGAGGG + Intergenic
1062271658 9:135712657-135712679 CTGGGAAAGGGGCCCATCGCAGG - Intronic
1062352347 9:136145373-136145395 ATGTGTGAGTGGCCCATGGCTGG + Intergenic
1185691456 X:2158523-2158545 CTGTGTAAGGGTCCTTTGGCAGG + Intergenic
1192603328 X:72487552-72487574 CTTTGTAAGGGGTACATGTAAGG + Intronic
1200231756 X:154447274-154447296 TTGTGTCACGGGCCCCTGGAGGG + Intronic
1202082764 Y:21101765-21101787 GTGTGTAAGGAGCCCAAGGCTGG + Intergenic