ID: 906105682

View in Genome Browser
Species Human (GRCh38)
Location 1:43290737-43290759
Sequence CTGAGTGAACAGCAGGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906105674_906105682 24 Left 906105674 1:43290690-43290712 CCTGATGGCTTCTGTTTTTCCCG No data
Right 906105682 1:43290737-43290759 CTGAGTGAACAGCAGGAAGGGGG No data
906105675_906105682 5 Left 906105675 1:43290709-43290731 CCCGAGAAATAAGAAGCAGTGTC No data
Right 906105682 1:43290737-43290759 CTGAGTGAACAGCAGGAAGGGGG No data
906105676_906105682 4 Left 906105676 1:43290710-43290732 CCGAGAAATAAGAAGCAGTGTCC No data
Right 906105682 1:43290737-43290759 CTGAGTGAACAGCAGGAAGGGGG No data
906105672_906105682 26 Left 906105672 1:43290688-43290710 CCCCTGATGGCTTCTGTTTTTCC No data
Right 906105682 1:43290737-43290759 CTGAGTGAACAGCAGGAAGGGGG No data
906105673_906105682 25 Left 906105673 1:43290689-43290711 CCCTGATGGCTTCTGTTTTTCCC No data
Right 906105682 1:43290737-43290759 CTGAGTGAACAGCAGGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906105682 Original CRISPR CTGAGTGAACAGCAGGAAGG GGG Intergenic
No off target data available for this crispr