ID: 906107491

View in Genome Browser
Species Human (GRCh38)
Location 1:43303717-43303739
Sequence TGCAGTGGCAATATTGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 147}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906107491_906107498 9 Left 906107491 1:43303717-43303739 CCTGCCACAATATTGCCACTGCA 0: 1
1: 0
2: 1
3: 14
4: 147
Right 906107498 1:43303749-43303771 CCAGGCTGTTCCCTCTGTCTAGG 0: 1
1: 1
2: 9
3: 81
4: 533
906107491_906107494 -9 Left 906107491 1:43303717-43303739 CCTGCCACAATATTGCCACTGCA 0: 1
1: 0
2: 1
3: 14
4: 147
Right 906107494 1:43303731-43303753 GCCACTGCAGGCCTCTGTCCAGG 0: 1
1: 1
2: 4
3: 35
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906107491 Original CRISPR TGCAGTGGCAATATTGTGGC AGG (reversed) Intronic
900115699 1:1026940-1026962 GGCTGTGGCAAGATTGTGGCTGG + Intronic
901819043 1:11814298-11814320 TGCAGTGGCATGATCTTGGCTGG + Intronic
902821780 1:18947843-18947865 CGCCATGGCAATATTGTGACAGG + Intronic
905401551 1:37707275-37707297 TGCAGTGGAACTTCTGTGGCAGG - Intronic
906070594 1:43013612-43013634 GGCAGAGGCAGAATTGTGGCAGG + Intergenic
906107491 1:43303717-43303739 TGCAGTGGCAATATTGTGGCAGG - Intronic
907022924 1:51086580-51086602 TGCAGTGGCACTAATGTCCCAGG + Intergenic
908913911 1:69104103-69104125 TGCTGTGGCCATTTTGTGCCTGG + Intergenic
910264807 1:85327265-85327287 TGCAGTGGCACTATCTCGGCTGG - Intronic
910391739 1:86752591-86752613 TGCTGTGGCAATAATGGGGCTGG - Intergenic
915255308 1:154623946-154623968 TGCAGTGGCACGATCTTGGCTGG - Intronic
916707107 1:167362564-167362586 TGCAGTGGCATGATCGTAGCTGG + Intronic
920659704 1:207905188-207905210 TGCAGTGGCACGATCTTGGCTGG + Intronic
923753686 1:236770863-236770885 TGCAGTGGCACCATCTTGGCCGG - Intergenic
1070198672 10:74182767-74182789 TAACGTAGCAATATTGTGGCTGG - Intronic
1070219302 10:74423684-74423706 TACAGTGACAATGTTGGGGCTGG + Intronic
1070412425 10:76154797-76154819 TGCAGTGGCTCCATTGTGGCAGG + Intronic
1072496404 10:95964664-95964686 TGCAGTGCCATTAATGGGGCTGG + Intronic
1077514982 11:2996061-2996083 TGCAGTGACAATAGGCTGGCTGG - Intergenic
1078262991 11:9728923-9728945 TGCACTTGGAATGTTGTGGCTGG - Intronic
1078708153 11:13764935-13764957 GGCAGTGGCAATGTGGTGGATGG - Intergenic
1079018229 11:16887718-16887740 TGCAGTGGCATGATCTTGGCTGG + Intronic
1079088855 11:17466669-17466691 TGCAGTGGCACAATCTTGGCTGG + Intronic
1079248029 11:18767507-18767529 TGCTGTGGCAATATTTTAACTGG + Intronic
1082059320 11:47847159-47847181 TGAAGTGGAAAGAATGTGGCGGG - Intronic
1088677317 11:112206764-112206786 TACAGTTGCAATATTGTATCAGG - Intronic
1092931655 12:13321274-13321296 TGCAGTCGCAACATTTTGGGAGG - Intergenic
1094078604 12:26506753-26506775 TGCAGTAGACATATTGTAGCAGG - Intronic
1097701638 12:62826475-62826497 TTGAGTGGCAATATGGTAGCCGG - Intronic
1103251563 12:119504468-119504490 TGCAGTGGCATTCTTGGGGGAGG - Intronic
1104307165 12:127620037-127620059 TGCATTTGCAAAACTGTGGCAGG + Intergenic
1107135950 13:36944286-36944308 TTCAGTGCCCATATTGTGGAAGG + Intergenic
1108343044 13:49516338-49516360 TGCAGTAGCTATGATGTGGCAGG - Intronic
1108912669 13:55576716-55576738 TTCAGTGGCACAATGGTGGCTGG + Intergenic
1109654229 13:65368481-65368503 TGCTGTAGTAATATTGAGGCAGG + Intergenic
1110431631 13:75430888-75430910 TACACTGGCAAGATTGTGGGTGG - Intronic
1112864639 13:103878544-103878566 TGCAGTGGCATAAATGTGGTGGG + Intergenic
1113392613 13:109911807-109911829 TGCAGTGGCACGATCTTGGCTGG - Intergenic
1113396789 13:109955439-109955461 TGCAGTGGCAGGAGTGTTGCAGG - Intergenic
1117214360 14:53535340-53535362 TGGAGTTGCAATGCTGTGGCCGG - Intergenic
1123761586 15:23437828-23437850 TGCAGTGGCACAATCTTGGCTGG + Intergenic
1127075757 15:55323940-55323962 TGCAGTGGCACCATCTTGGCTGG + Intronic
1128059918 15:64728774-64728796 TGCAGTGGCAGTGCAGTGGCAGG - Intergenic
1128745892 15:70113869-70113891 AGCAGAGGCAATACTGTGGCTGG - Intergenic
1129105343 15:73303466-73303488 TGCAGTTTCAGTATTGGGGCGGG + Exonic
1129147350 15:73660788-73660810 TGCAGTGGCAAAATATTGGAAGG - Intergenic
1129973674 15:79803102-79803124 TGCAGTGGGTAGAGTGTGGCAGG - Intergenic
1137692785 16:50441107-50441129 TGCAGTGGGAGAAGTGTGGCTGG + Intergenic
1144082588 17:11778273-11778295 TGCAGTGGCACTGTTTTGGCTGG - Intronic
1146930033 17:36770244-36770266 TGCAGTGGCACAATCTTGGCTGG - Intergenic
1148181844 17:45611605-45611627 TGCAGTGGCACAATCCTGGCTGG - Intergenic
1150623129 17:66823170-66823192 TGCAGTGGGAAGATTGTAGCTGG + Intergenic
1153207540 18:2719348-2719370 TGCAGTGGCATGATCTTGGCTGG + Intronic
1153690366 18:7586331-7586353 TGCACTGGCAATGAGGTGGCAGG + Intronic
1153817051 18:8799654-8799676 ATCAGTGGCAATATTATGGGAGG - Intronic
1155900283 18:31381275-31381297 TGGAATGGCAATGTAGTGGCTGG - Intronic
1164946424 19:32297196-32297218 TGCAGTGGCACAATCTTGGCTGG + Intergenic
1165381307 19:35482644-35482666 TGCAGTGGCATGATCTTGGCTGG - Intergenic
1165541350 19:36494496-36494518 TGCAGTGGCATGATCTTGGCTGG - Intergenic
1165934035 19:39378309-39378331 TGTAGTGACAAGATTGTGTCAGG + Intronic
1166176021 19:41070550-41070572 TGCAGTGGCACAATCTTGGCTGG - Intergenic
1167029641 19:46949100-46949122 TGCAGTGGCACGATCTTGGCTGG - Intronic
1167878632 19:52435556-52435578 TGCAGTGGCATGATTATGGCTGG + Intronic
928706134 2:33951691-33951713 TCCAGTGGCTTCATTGTGGCTGG + Intergenic
928756702 2:34534988-34535010 TGCGCTGGCAAAATTGTGGTGGG + Intergenic
929457944 2:42079333-42079355 CGCAGTGGTAAGATTGGGGCTGG - Intergenic
930187473 2:48424694-48424716 TTCAGTGACATTATTTTGGCAGG - Intergenic
931078677 2:58744616-58744638 TGCAGTGGGTAAACTGTGGCTGG + Intergenic
931900933 2:66787303-66787325 TTCAGTGGTAATATTAAGGCAGG - Intergenic
932538073 2:72620273-72620295 TGCAGTGGGGATGTTGTGGGTGG + Intronic
932586958 2:73036425-73036447 TGCAGTGTCCATCTGGTGGCTGG - Intronic
932915394 2:75852943-75852965 TGCAGTTGTAACTTTGTGGCAGG + Intergenic
933951478 2:87334091-87334113 TGCAGTGGCACAATCTTGGCTGG - Intergenic
934134587 2:88983372-88983394 TGCAGTGGCACAATCTTGGCTGG + Intergenic
934235725 2:90230396-90230418 TGCAGTGGCACAATCTTGGCTGG - Intergenic
936987042 2:118321494-118321516 TCCTGTGGCAACATTTTGGCAGG + Intergenic
938092733 2:128443972-128443994 TCCAGTGGCCATCTTGGGGCAGG + Intergenic
939372310 2:141317044-141317066 TGCACTGGGCATAATGTGGCAGG + Intronic
940662181 2:156560187-156560209 TGCCGTGCCCATATTGTGGGTGG + Intronic
941069217 2:160937793-160937815 TGTAATGGCAATATTTTTGCAGG - Intergenic
942116474 2:172734576-172734598 TGCTGTGGGAACACTGTGGCAGG + Intergenic
942964965 2:181881029-181881051 TAAAGTGGCAACATTATGGCTGG - Intergenic
943214375 2:185012247-185012269 TGCAGTGGCACGATCCTGGCTGG - Intergenic
944344195 2:198640703-198640725 TGCAGTGGCCAGACTGTGCCAGG - Intergenic
945417440 2:209591473-209591495 GGCAGTGGGAAAATTGTGGTGGG - Intronic
945857473 2:215085749-215085771 TGCAGTAGAATTATTGGGGCAGG + Intronic
946103707 2:217351368-217351390 TGCAATGGCAGTATGGTGGTGGG + Intronic
947379352 2:229530252-229530274 CACAGTGGCAATATTTTGGCAGG - Intronic
1169685411 20:8266299-8266321 TGGAGGGGCAATGATGTGGCTGG + Intronic
1170122611 20:12926919-12926941 TGCAGTGACTATATTGTCTCTGG + Intergenic
1173486603 20:43445756-43445778 TGCAGTGGCACGATCGTGGCTGG + Intergenic
1174202461 20:48816602-48816624 TGATGTGGCTATGTTGTGGCAGG + Intronic
1178722145 21:35019472-35019494 TGCACTGGCAGTATTATGCCAGG - Intronic
1182933380 22:34196015-34196037 TGCACTGGCAACACTGTGGTAGG + Intergenic
949610406 3:5698297-5698319 TGCTGTAGGAATATTTTGGCTGG + Intergenic
950381895 3:12623156-12623178 TGCAGGGGCACAAGTGTGGCAGG - Intronic
950781912 3:15399448-15399470 TGCAGTGGCACAATTGTTACCGG - Intronic
952833834 3:37587939-37587961 TGCAGTGGCAGAATTGGAGCTGG + Intronic
955469408 3:59270695-59270717 GGCAGTGGCAAAATTGTCACTGG + Intergenic
957309563 3:78502234-78502256 TTCAGTGGCAAACTTGTGGAAGG + Intergenic
958762707 3:98328124-98328146 TGCATTGGCAAATTTGTGGAAGG - Intergenic
959563713 3:107813006-107813028 TGCAGTGGGAATAGTGTGGGAGG - Intergenic
960297394 3:115960759-115960781 TCCAGGGGCATTATTTTGGCAGG - Intronic
966666422 3:182477160-182477182 TGTAGGGCCAATATTATGGCTGG + Intergenic
967131801 3:186477342-186477364 TGCATTGGCAACATTTTGACGGG + Intergenic
969664881 4:8551619-8551641 TCCAGCAGCCATATTGTGGCAGG + Intergenic
969669459 4:8581761-8581783 TGCAGGGGCAGTGCTGTGGCTGG - Intronic
970732085 4:19117624-19117646 TGCTGTGGTAATGATGTGGCTGG - Intergenic
972501133 4:39679157-39679179 TGCAGTGACACGATTTTGGCTGG + Intergenic
975723024 4:77266612-77266634 TGCAGTTGCAGCATTGAGGCAGG - Intronic
977142518 4:93391464-93391486 TGCAGTGGATATTTTGTGTCCGG + Intronic
978151765 4:105444540-105444562 TGCAGTGGTATTAATCTGGCAGG - Intronic
978249333 4:106611118-106611140 TGGAGTGTCAATTTTCTGGCTGG - Intergenic
978897442 4:113905922-113905944 TGCAGTGGCAGTACTTTGGGAGG - Intronic
979059519 4:116039610-116039632 TGCAGTGGTAATATTGGGAGTGG + Intergenic
981088943 4:140712820-140712842 TGCAGTGGCATGATTGTTTCCGG + Intronic
982475129 4:155841215-155841237 GGCAGTTACAATATTTTGGCAGG + Intronic
983324055 4:166230056-166230078 TGCAGTGGCATGATCTTGGCTGG + Intergenic
989060537 5:37407105-37407127 TACAGTGGCAAGATCATGGCTGG - Intronic
992552768 5:77874868-77874890 TGCAGGGGCAAAACTGTGGGAGG + Intergenic
993509252 5:88751265-88751287 TGCAGAGACAAATTTGTGGCAGG + Intronic
994613808 5:102078425-102078447 AGCAGCAGCAGTATTGTGGCAGG - Intergenic
998801779 5:145876110-145876132 TGCAGTGGCATAATTGTAGCTGG - Intergenic
999108257 5:149093138-149093160 TGCAGTGGCTTCATTGTGGGGGG - Intergenic
1001625950 5:173132652-173132674 TGCAGTGGCATGATCTTGGCTGG + Intronic
1006472216 6:34235607-34235629 TGCAGTTGCAGGAATGTGGCAGG - Intergenic
1006859313 6:37159482-37159504 GGCAGGGGCAAGATTGAGGCAGG + Intergenic
1009694868 6:67089186-67089208 TGCAGCAGCAACATAGTGGCAGG + Intergenic
1010796177 6:80119371-80119393 TGCAGTGGCATAATCTTGGCTGG + Intronic
1011239356 6:85254907-85254929 TGCAGTCACAACCTTGTGGCCGG + Intergenic
1017451439 6:154557957-154557979 TGCAGTGGCATGATCTTGGCTGG - Intergenic
1018129449 6:160715048-160715070 TTCACTTGCAATATTGTGGGAGG - Intronic
1028017336 7:85732349-85732371 TGCAGTGGCACAATCTTGGCAGG - Intergenic
1028599439 7:92585873-92585895 TGGAGTGGCAGTATTGTGGTTGG - Intronic
1031812050 7:126382593-126382615 TGAAATGCAAATATTGTGGCGGG - Intergenic
1032544700 7:132731915-132731937 TGCAGTGGCGATTTGGTGGGTGG + Intergenic
1033944429 7:146698564-146698586 TGCAGTTGGAATATTATGCCAGG + Intronic
1036741864 8:11370291-11370313 AGCAATGCTAATATTGTGGCTGG - Intergenic
1038945046 8:32349882-32349904 TGCAGCAGCAGGATTGTGGCTGG + Intronic
1045048110 8:98298283-98298305 TGCAGTGGTACAATTTTGGCAGG + Intergenic
1045913884 8:107443289-107443311 TGCAGTGGAAAGATTGTGACCGG + Intronic
1047048826 8:121085781-121085803 TGCAGAGGCCACAATGTGGCTGG + Intergenic
1047362403 8:124181142-124181164 TTCAGTGGCAAATATGTGGCTGG + Intergenic
1050963539 9:11767776-11767798 TGCAGTGGCACGATCTTGGCTGG + Intergenic
1052308075 9:27033517-27033539 TGCAGTGGCATGATTTTGGTTGG - Intronic
1052790156 9:32868019-32868041 TGTACTGGCAGGATTGTGGCAGG + Intergenic
1053089557 9:35262369-35262391 TGCAGTGGCATGATCTTGGCTGG + Intronic
1056697007 9:88867221-88867243 TGCAGAAGAAATATTGAGGCTGG + Intergenic
1056757515 9:89391207-89391229 TGCCATGGCAATAGTGTGCCTGG - Intronic
1058077111 9:100662357-100662379 TGCTCTGGCAATACTGTGCCTGG + Intergenic
1058601300 9:106673600-106673622 TGAAGTGGCAGTATTGTGAGTGG + Intergenic
1059937608 9:119327029-119327051 TGCAGTGGGAATTTTGAGGCAGG + Intronic
1061592899 9:131609572-131609594 TGCACTGGCCAGAGTGTGGCAGG + Intronic
1186352397 X:8753585-8753607 TGCAGTGCCAGTATTTTGGGAGG - Intergenic
1189673595 X:43438391-43438413 CACAGTGGCAAAACTGTGGCAGG - Intergenic
1193249529 X:79272524-79272546 AGCAATGGCAAGATTGTAGCTGG - Intergenic
1194097989 X:89666588-89666610 TGCAGAGGCACAATTCTGGCTGG - Intergenic
1196746181 X:119073340-119073362 GACAGTGGCAACACTGTGGCCGG + Intergenic
1197540101 X:127747951-127747973 TGCAGTGGCATGATTAGGGCTGG - Intergenic
1198497703 X:137209691-137209713 TGCAGTGGCAATATTTTGGAAGG - Intergenic
1199459745 X:148071525-148071547 TGCAGTGGCATCATTGGGTCTGG + Intergenic
1199476438 X:148251501-148251523 TGAGGTGGCTATAGTGTGGCTGG - Intergenic
1200451011 Y:3327977-3327999 TGCAGAGGCACAATTCTGGCTGG - Intergenic