ID: 906108095

View in Genome Browser
Species Human (GRCh38)
Location 1:43306635-43306657
Sequence TTGGTGATTTACTGGGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 192}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906108095 Original CRISPR TTGGTGATTTACTGGGTGGC TGG Intronic
900835661 1:5001752-5001774 TTTGTTTTTTACTGGGTTGCTGG - Intergenic
901169499 1:7246385-7246407 TTGTTGATTTACTGTGTGCCCGG - Intronic
901177951 1:7318320-7318342 TTGGTCAGTGACTGGTTGGCTGG + Intronic
901318036 1:8322112-8322134 TTGGTGACTGAGTGGGTGGATGG + Intronic
901754713 1:11434575-11434597 TTTGTGATTTCCTGGGTGAGAGG - Intergenic
901839919 1:11947759-11947781 TCGGTCAGTTACTGGGTGGAGGG + Intronic
902163537 1:14551653-14551675 TTGGTGAGTTAGTGGGTGGAGGG + Intergenic
902175925 1:14650803-14650825 TTGGTGCTTTTCTGGGTTTCTGG + Intronic
902942484 1:19810587-19810609 TTCCTGATTTAGTGGGTGCCTGG - Intergenic
903056702 1:20641082-20641104 TTGGTGATTTACTGGAGGGCTGG + Intronic
905017492 1:34787623-34787645 TGGGGGATTTACTTGGTTGCTGG - Intronic
906108095 1:43306635-43306657 TTGGTGATTTACTGGGTGGCTGG + Intronic
907467821 1:54651199-54651221 TTGGACATTTACTGTGTGCCAGG + Intronic
908578687 1:65490173-65490195 TTGGATATTTACTAGGTGCCAGG - Intronic
908680372 1:66654084-66654106 TTGTTGATTGTCTGGGTGGATGG + Intronic
913414364 1:118589153-118589175 TTGGGAATTTTCTGTGTGGCTGG - Intergenic
914852105 1:151322511-151322533 ATGGTGATTAACTGGGTGAGGGG - Intronic
916261292 1:162845075-162845097 ATGGTGATTTACTTGGAGGTTGG + Intronic
916298269 1:163244648-163244670 TTGTTGATTCACTGGGTGATTGG + Intronic
916378869 1:164186963-164186985 TTGCTGATTTACTGAGTGGCTGG + Intergenic
917531749 1:175842075-175842097 CTGGTAATTTATTGGGAGGCAGG + Intergenic
918127819 1:181599700-181599722 CTGGTGATTTACTGGATGGATGG + Intronic
918135494 1:181670288-181670310 TTGGTTATATACTGGGTGCTTGG + Intronic
919553486 1:199023091-199023113 TAGGTGATTTACTGGGCATCTGG + Intergenic
920269248 1:204751047-204751069 TTGGTGTCTTAAGGGGTGGCAGG + Intergenic
923010166 1:230082385-230082407 TTGGTGATTTCATAGGTGTCTGG + Intronic
923557660 1:235013418-235013440 TTGGATATTTACTGTGTTGCAGG - Intergenic
924451804 1:244185142-244185164 TGGCCGTTTTACTGGGTGGCAGG + Intergenic
1063378456 10:5569086-5569108 TTGGTGCTTGACTGGTTGGTTGG + Intergenic
1063378494 10:5569285-5569307 TTGGTGATTTGTTGGTTGGCTGG + Intergenic
1064963945 10:20996422-20996444 GTGGTTATTTCCTGGGTGCCTGG + Intronic
1064986750 10:21218103-21218125 TTGGTGATTGCCTGGGTGTCAGG - Intergenic
1065819489 10:29512062-29512084 ATGGTGACTTACTTGCTGGCTGG - Intronic
1069619675 10:69829153-69829175 TTGGTGATTGACGGGGTGTGAGG - Intronic
1069824456 10:71246552-71246574 TTGGTGAGTGACTGGGTTGAGGG + Intronic
1069973126 10:72190397-72190419 TTGGTGATCCACTGGGTGTCAGG - Intronic
1073055558 10:100698512-100698534 TTGATAATTTATTGGGTGCCAGG - Intergenic
1074599705 10:114901165-114901187 TTGGTGATCCACTGGGTGTCAGG - Intergenic
1076033475 10:127178641-127178663 TTGGTGCTTTACTAGGTGCTGGG + Intronic
1076561159 10:131365373-131365395 TTGGGGACCTACTGGGTGACAGG - Intergenic
1077315999 11:1919625-1919647 TTGGCCAGTGACTGGGTGGCCGG - Exonic
1077489521 11:2854107-2854129 TTTGAGATTTTCTGTGTGGCAGG - Intergenic
1079081048 11:17413993-17414015 TTGGTCACTTACTGGCTGGGTGG + Intronic
1082985075 11:59161419-59161441 TTGGTGTCTTACCTGGTGGCAGG - Intergenic
1083143860 11:60743290-60743312 TTGGTGAGTTGCCTGGTGGCTGG + Intronic
1084992532 11:72940933-72940955 TTGGTGATCCATTGGGTGTCAGG - Intronic
1085607548 11:77915635-77915657 TTGGTGACTTGCTGGGTGCAGGG - Intronic
1087137409 11:94734843-94734865 TTGGTGATTTCCTTGGGGGCTGG + Intronic
1088139409 11:106597385-106597407 CTAGGGATATACTGGGTGGCTGG - Intergenic
1088225753 11:107617988-107618010 TTGATAATGTTCTGGGTGGCTGG + Intronic
1089099498 11:115950347-115950369 TTGGTGATTCACTGGGTGTCAGG + Intergenic
1089101198 11:115964135-115964157 TTGGGCATTTACTGTGTGCCAGG + Intergenic
1089313561 11:117575531-117575553 GTGGTGATTTGCTGTATGGCTGG + Intronic
1090067108 11:123512378-123512400 TTGGGGATTTATTCTGTGGCTGG + Intergenic
1090406930 11:126481811-126481833 TGGGTGAATTACTGGTTGACTGG - Intronic
1090475030 11:127012706-127012728 TTACTGCTTTACTGGGAGGCTGG - Intergenic
1090873768 11:130770787-130770809 TTGATGACTTACTGTGTGCCAGG + Intergenic
1091214571 11:133892875-133892897 TTGTTGATTGACTGGGTGACTGG + Intergenic
1092140006 12:6177427-6177449 CTGGTGATTTATTGGGTAGATGG - Intergenic
1092437400 12:8461053-8461075 TTGGTGATCCACTGGGTGTCAGG - Intronic
1095523867 12:43101555-43101577 TTGGTGAGTTACTGTGGAGCAGG - Intergenic
1100619154 12:96255157-96255179 TTGGTGACTGACTGGGTGGGAGG + Intronic
1105916339 13:24920448-24920470 TTGGTTATTAAATGGTTGGCAGG - Intronic
1108767273 13:53647397-53647419 TTGAGGATTTACTGGTTGTCAGG - Intergenic
1112850583 13:103701203-103701225 TTGGTGAATGAATGGATGGCTGG - Intergenic
1113098177 13:106688510-106688532 TTGCTGATTGGCTGGGTGGGGGG + Intergenic
1113212125 13:107995405-107995427 TTGGTTACATACTGGGTGGCTGG - Intergenic
1113301839 13:109030893-109030915 TTGGTAATTAATTGGGTGTCTGG - Intronic
1119837279 14:77761655-77761677 TTGGTAATTTACCGAGTGTCTGG + Intronic
1121551060 14:94801005-94801027 TTGGTGATCCACTGGGTGTCAGG + Intergenic
1122628096 14:103094450-103094472 TTGGTGGTGTTTTGGGTGGCAGG + Intergenic
1126117738 15:45224345-45224367 TTGGTGATTTTCAGGAAGGCAGG - Intergenic
1126485666 15:49177757-49177779 TTGGTGATCCACTGGGTGGCAGG + Intronic
1128262166 15:66240096-66240118 CTGGTGCTTTATTGGGGGGCTGG - Intronic
1128332324 15:66763704-66763726 TTGGTGATTTACATGTTAGCTGG - Intronic
1129511689 15:76128477-76128499 TTTTGGATTTACTGGGTGGGTGG - Intronic
1130239411 15:82172400-82172422 TAGGTGATTTAGTGAGTGACTGG + Intronic
1130416348 15:83698015-83698037 TTTGTGATTTCCTGAGTGACAGG - Intronic
1134653875 16:15931854-15931876 TTGGTGATCCACTGGGTGTCAGG + Intergenic
1135493496 16:22931164-22931186 TTGGTCATTTCCTGGTTGGGTGG + Intergenic
1139140051 16:64250859-64250881 ATGGTGACTTACTGTGTGCCAGG + Intergenic
1140661350 16:77193467-77193489 GTGGTGATGGGCTGGGTGGCTGG - Exonic
1141585199 16:85028641-85028663 TTTGTGCTTTCCTGGGTTGCAGG + Intronic
1143979997 17:10860688-10860710 ATGGTGATTCACAGGGTGTCAGG + Intergenic
1144454662 17:15408927-15408949 TTGGTGAGGTGCTGGGTGCCGGG + Intergenic
1145836189 17:27956024-27956046 TTGTTCATTTACTGTGTGCCAGG + Intergenic
1146091166 17:29879773-29879795 TTGATGATTTTCTGATTGGCTGG - Intronic
1148013853 17:44506853-44506875 TGGGTGATTTCCTGAGTAGCTGG - Intergenic
1148244494 17:46021500-46021522 TTGGTGATTTCCTGGGTGAAAGG + Intronic
1161006225 19:1938252-1938274 TTTGGGATTTACTGGGAGGCTGG + Intergenic
1161267360 19:3370428-3370450 TTGGTGATTTACAGGGCGCTTGG - Intronic
1161349560 19:3784417-3784439 TTGGTGATACACTGGGTGCCCGG + Exonic
1161963263 19:7534424-7534446 TTGGAAAATTCCTGGGTGGCCGG - Exonic
1163494018 19:17634204-17634226 TGGGTCATTTAATGGGTGGGTGG - Intronic
1167094017 19:47364034-47364056 ATGGTGGTTTACAGGTTGGCAGG + Intronic
925992157 2:9262438-9262460 TTGGTGATCTCCTGTGAGGCAGG + Intronic
927248030 2:20973695-20973717 TCAGGGATTTGCTGGGTGGCTGG + Intergenic
928310239 2:30203726-30203748 TTGGCGATTTGCTGTGTGCCAGG + Intergenic
929341850 2:40829096-40829118 TTGGTGTTTTACTTTGGGGCTGG + Intergenic
932177904 2:69619459-69619481 TTGTTGATTAAATGGGTGGATGG - Intronic
932188629 2:69719980-69720002 TTGATCATTTACTGGTTGCCTGG - Intronic
933087796 2:78077598-78077620 ATGGTGATTTACATGTTGGCAGG + Intergenic
937085489 2:119169085-119169107 TTGGGGATTGGCTGAGTGGCTGG - Intergenic
938751430 2:134334441-134334463 TTGGTTATTTACTTGGTGTAAGG + Intronic
939134672 2:138279037-138279059 TTGGTGATCCACTGGGTGTCAGG - Intergenic
942488476 2:176465362-176465384 TTGGTGATTTACATGGGTGCAGG + Intergenic
944606815 2:201359128-201359150 TTGGTGATTGACTGGATGCTGGG + Intergenic
944707506 2:202306054-202306076 TTTCTGATTTACTGGGTATCGGG + Intergenic
946742049 2:222812489-222812511 TTGAGCATTTACTGGGTGGGAGG - Intergenic
946792965 2:223320127-223320149 CTGGTGACTTAATGTGTGGCTGG - Intergenic
946823829 2:223656345-223656367 TCAGTGATTGTCTGGGTGGCAGG + Intergenic
1170438118 20:16350844-16350866 TGGGTGATCCACTGGGTGACTGG + Intronic
1170634132 20:18090272-18090294 TTGGTGATCCACTGGGTGTCAGG + Intergenic
1173441235 20:43078147-43078169 TTGGTCATTTACTCTGTGCCAGG - Intronic
1176057837 20:63158222-63158244 TAGGTGAATGACTGGGTGGGTGG + Intergenic
1178736634 21:35158398-35158420 CAGGTGATTGACTTGGTGGCAGG - Intronic
1178884467 21:36474610-36474632 TCGGTGTTGTTCTGGGTGGCGGG - Intronic
1178955769 21:37020249-37020271 TTTTTAATTAACTGGGTGGCTGG - Intergenic
1181792684 22:25280407-25280429 TTGAGGATCTACTGGGTGCCAGG + Intergenic
1181831204 22:25562210-25562232 TTGAGGATCTACTGGGTGCCAGG + Intergenic
1184530653 22:45053239-45053261 GTGCTGATTTACTGAGTGCCAGG - Intergenic
1184806072 22:46795668-46795690 TTGATCATTTACTGTGTGGCAGG + Intronic
949465354 3:4337899-4337921 TTGGGGGTTTACTGGGAGGGAGG - Intronic
951555795 3:23919322-23919344 TTGGTGATCCACTGGGTGTCAGG - Exonic
954396663 3:50296788-50296810 TTGGGGCCTTCCTGGGTGGCCGG + Exonic
954829058 3:53402767-53402789 TTGGTGATTTTCTGGGAGTAGGG - Intergenic
955321923 3:57980730-57980752 TTGGTGGTTTCCTGTGTGCCAGG + Intergenic
956295227 3:67705008-67705030 TTCTGGATTTCCTGGGTGGCAGG + Intergenic
957525147 3:81371044-81371066 TTGGTGGTTTACCAAGTGGCTGG - Intergenic
957942841 3:87026749-87026771 TTGGTGATCTACTGGTAGGGAGG - Intergenic
958598315 3:96259879-96259901 TTGGTGCTTTAGTGGATGGAGGG - Intergenic
962287062 3:134095191-134095213 TGGGTGATTTTCTAGGTGGCTGG - Intronic
963076923 3:141355662-141355684 CTAGAGATTTACAGGGTGGCAGG - Intronic
964609354 3:158594713-158594735 TTGGTGATTGACAGGGTTGAAGG + Intronic
966508731 3:180736548-180736570 ATGGTGACCTACTGGGAGGCGGG - Intronic
968515271 4:1012994-1013016 TTGGTAATATACTTGGTGTCTGG + Intronic
970047151 4:11867614-11867636 TTGGTATTTTACAGTGTGGCTGG - Intergenic
977350039 4:95872348-95872370 TTGGGCATCTACTGGGTGCCAGG - Intergenic
978930251 4:114302243-114302265 TTGGTGAAATACTCTGTGGCAGG + Intergenic
979524798 4:121705617-121705639 TTTGGGATTTTCTGGGTGGTAGG - Intergenic
980054815 4:128069171-128069193 TTGGTGATCCATTGGGTGTCAGG + Intronic
980647900 4:135668089-135668111 TTGGTTATTTACTGGGTTAAGGG - Intergenic
980647971 4:135669842-135669864 TTAGTGATTTAGTAGATGGCAGG + Intergenic
981433554 4:144691712-144691734 TACATGTTTTACTGGGTGGCTGG - Intronic
982292124 4:153790954-153790976 TTGGGGATTTAGGGGTTGGCCGG - Intergenic
983065260 4:163203051-163203073 TTGAGTATTTACTGGGTGCCAGG + Intergenic
984014460 4:174409024-174409046 TTGGTGCTTTCCTGGCAGGCAGG - Intergenic
986020503 5:3796949-3796971 ATGGTGAATTACTGGATGGGTGG + Intergenic
986265494 5:6186765-6186787 TTTGTAATTTCCTGGGTGACAGG + Intergenic
986482809 5:8205626-8205648 TTGGAGATTTAGTGGTTGGAAGG + Intergenic
987543532 5:19284661-19284683 TTGATGATTTAGGGGGTGGAAGG - Intergenic
988443235 5:31256245-31256267 TGAGTGATTTACTGGCTGTCAGG + Intronic
990133963 5:52622143-52622165 TTGTGGATTTACTAGGTGCCGGG + Intergenic
990274164 5:54177721-54177743 GTGGTGATTTGGAGGGTGGCCGG - Intronic
990567332 5:57042688-57042710 CTGGTGATTTACTGGCTGTTAGG - Intergenic
991450919 5:66749968-66749990 TTGATTCTTTATTGGGTGGCAGG + Intronic
992911608 5:81401004-81401026 CTGGTGGTTTTCTAGGTGGCTGG - Intergenic
993846011 5:92944511-92944533 TTGCTGAATTATTGGGAGGCTGG - Intergenic
994516617 5:100780296-100780318 TTGGTGATCTACTGAGTGGGGGG + Intergenic
996815889 5:127572132-127572154 CTGGGGATTTGCTGGGTGGATGG - Intergenic
999451162 5:151679338-151679360 TGAGTGAGTGACTGGGTGGCAGG + Intronic
1001505462 5:172275934-172275956 TTGGTGATTTATTGGATGTAGGG - Intronic
1002949782 6:1798609-1798631 TTGGAGATTCAGCGGGTGGCTGG - Intronic
1004092144 6:12514545-12514567 TTGGTGATCCACTGGGTGTCAGG - Intergenic
1004314389 6:14573030-14573052 TGGGTGTTTTAGTGGCTGGCTGG - Intergenic
1006921906 6:37632942-37632964 ATGGTGATTATGTGGGTGGCTGG + Exonic
1009859773 6:69312236-69312258 TTGGTGATTGACTGGATGTGAGG + Intronic
1010054784 6:71552158-71552180 TTCATGATCTACGGGGTGGCAGG - Intergenic
1010127855 6:72454871-72454893 TTGTTGGTTTGCTGGGTGGGTGG - Intergenic
1010200215 6:73275530-73275552 TCAGTGCTTTACTTGGTGGCTGG + Intronic
1010589135 6:77692309-77692331 TTGTTTATTTACTTGGTTGCAGG + Intronic
1011088575 6:83570537-83570559 CTGGAGGTTTACGGGGTGGCGGG + Intronic
1012737901 6:102974094-102974116 TTGTAGACTTGCTGGGTGGCTGG + Intergenic
1013987459 6:116212674-116212696 GTTGAGATTTAATGGGTGGCAGG + Intronic
1014227478 6:118864460-118864482 TTGGTGCTTTTGTGGGTGGAGGG - Intronic
1018178167 6:161196919-161196941 TTGGGCACTTACTGGGTGCCCGG + Intronic
1018400027 6:163413602-163413624 TTCGTGATTTGCTGAGAGGCTGG - Intergenic
1019744429 7:2691758-2691780 TTGGGGCTTTGCAGGGTGGCAGG + Intronic
1020411374 7:7895548-7895570 TCAGTATTTTACTGGGTGGCGGG - Intronic
1021908442 7:25360012-25360034 ATGTTTATTTACTGAGTGGCAGG + Intergenic
1024908891 7:54421955-54421977 TTGGGGATCTTCTGGGTGTCTGG + Intergenic
1025845404 7:65192294-65192316 TTGGTGACTTGCTGGGTGCAGGG + Intergenic
1025895680 7:65698326-65698348 TTGGTGACTTGCTGGGTGCAGGG + Intergenic
1028829298 7:95309756-95309778 TTGGTCATTTACTGTATGCCAGG - Intronic
1030781909 7:113611254-113611276 TTGGTGGATAACTGGGTGGCTGG + Intergenic
1031329874 7:120451262-120451284 TTGGTGATTTACTGGACGTTAGG - Intronic
1031949619 7:127878662-127878684 CTGGTGGTTTTCTTGGTGGCAGG + Intronic
1032834461 7:135660474-135660496 TTGGTGATCGACTGGGTGTCAGG - Intergenic
1034313050 7:150106835-150106857 CAGGAGATGTACTGGGTGGCTGG + Intergenic
1034440690 7:151084261-151084283 TTGGTGTGTTACTGTGTGGATGG + Intergenic
1034793814 7:153993829-153993851 CAGGAGATGTACTGGGTGGCTGG - Intronic
1038540730 8:28387712-28387734 TTGCTGAATTACTGGGTAGCAGG - Intronic
1039218847 8:35305428-35305450 GGGGTGATTTCCTGGGTGTCTGG - Intronic
1042598820 8:70477992-70478014 TTGATGATTATCTGGGTGGGAGG - Intergenic
1044844242 8:96364666-96364688 GTGATGATTTGCTGGGGGGCTGG - Intergenic
1045822192 8:106352231-106352253 TTAGTGATTAACTGGATGGGTGG + Intronic
1045953633 8:107881325-107881347 TTGGTGTTTTACTGTATGCCAGG - Intergenic
1046474915 8:114729618-114729640 TTAGTCATTTACTGGCTGTCAGG + Intergenic
1047955595 8:129973101-129973123 TTGGAGAGCTCCTGGGTGGCTGG - Intronic
1048218788 8:132521691-132521713 TTGGTAAAATATTGGGTGGCTGG - Intergenic
1048875577 8:138834715-138834737 TTGGTGATCTACTGTATGTCAGG - Intronic
1048876401 8:138839697-138839719 TTGGTGATTATCTGGATGGGGGG + Intronic
1052729081 9:32264393-32264415 TTGGTGATTACATGGTTGGCTGG - Intergenic
1053361274 9:37488344-37488366 CTGCTGATTGACTGAGTGGCTGG + Intronic
1056682272 9:88730319-88730341 TTGGTGAGTTGGTGGGTGGATGG - Intergenic
1058075802 9:100649532-100649554 TTGGTGTTTTTCTGGGTTGGTGG + Intergenic
1059228701 9:112697156-112697178 TTTGTGATTTCCTGGGTGATGGG - Intronic
1059765085 9:117376458-117376480 TTGGTGATTCTCTGGGTTGATGG + Intronic
1060040158 9:120293461-120293483 TTGGTGAGTTAGTTGGTGGGTGG + Intergenic
1060108519 9:120890109-120890131 TGGGACATTTACTGGGTGCCAGG - Intronic
1061199451 9:129128556-129128578 TTAGTGTATTTCTGGGTGGCAGG + Intronic
1062649741 9:137569438-137569460 TGGGTGAGTGACTGGCTGGCTGG - Intronic
1187228582 X:17398623-17398645 GTGATGAGTTACTGGTTGGCTGG + Intronic
1189399516 X:40653987-40654009 TTTGTGATGTACAGAGTGGCAGG + Intronic
1191181952 X:57573895-57573917 GTGGTGATTTCCTGGATGTCAGG + Intergenic
1192468790 X:71378528-71378550 TTGGGGAGATACTGGGTGGTAGG + Intronic
1194132907 X:90104597-90104619 TTGGTGAATTTCTCAGTGGCTGG + Intergenic
1194577128 X:95627048-95627070 TGGGTCATTTTCTGGGTGGGGGG - Intergenic
1194612947 X:96065989-96066011 TTGTTGATTTTCTGTGTGGAAGG + Intergenic
1195466968 X:105190210-105190232 TGGGTCATTCACTGGGTGGGGGG + Intronic
1197082213 X:122432949-122432971 TTGGTCATTTATTGTCTGGCAGG + Intergenic
1198440288 X:136656668-136656690 ATGATGAATTACTGGGTGGAGGG + Intronic
1198703910 X:139426609-139426631 TTGGTTACTTACTGTGTGCCTGG + Intergenic
1200478695 Y:3674675-3674697 TTGGTGAATTTCTCAGTGGCTGG + Intergenic
1200958120 Y:8971622-8971644 TGGGTGATATACTGGGTGACTGG + Intergenic