ID: 906112970

View in Genome Browser
Species Human (GRCh38)
Location 1:43336927-43336949
Sequence CTGTTTGCTCAGATTGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 512
Summary {0: 1, 1: 0, 2: 8, 3: 132, 4: 371}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906112970 Original CRISPR CTGTTTGCTCAGATTGGAGA TGG (reversed) Intergenic
900477994 1:2885042-2885064 CTCTTTGCCCAGGTTGGAAATGG + Intergenic
901100812 1:6717182-6717204 CTGTTTCCTCATATGGCAGAAGG + Intergenic
901775951 1:11560568-11560590 CTGTGTGCTCAGATAGAAGTAGG - Intergenic
902034107 1:13444011-13444033 CTCTTTCTTCAGCTTGGAGAGGG + Intergenic
903232150 1:21928358-21928380 CTCCTTGCTGAGATTGGAAAGGG - Intronic
903817938 1:26078799-26078821 CTGATTGGTCAGGTTGGAGATGG - Intergenic
904375000 1:30075217-30075239 CTGATTGATCAGGTTGAAGATGG - Intergenic
904736220 1:32636159-32636181 CTGATTGGTCAGGTTGGAGATGG - Intronic
904978751 1:34479036-34479058 CTGTTCCATCAGAGTGGAGAAGG - Intergenic
905912870 1:41665559-41665581 CTGTTTGACAAGGTTGGAGAGGG + Intronic
906112970 1:43336927-43336949 CTGTTTGCTCAGATTGGAGATGG - Intergenic
906486381 1:46238560-46238582 CTGATTGGTCAGGTTGGAGATGG + Intergenic
907233246 1:53020900-53020922 CAGTTTGTTCTGACTGGAGACGG - Intronic
907510082 1:54951354-54951376 CTGGTTGGTGAGATTGGAGATGG + Intergenic
907652022 1:56304212-56304234 CTGTTTCCCCAAATTAGAGAGGG + Intergenic
908336998 1:63136493-63136515 GAGATTGCTGAGATTGGAGATGG - Intergenic
908546114 1:65163834-65163856 CTGATTAGTCAGGTTGGAGATGG + Intronic
908719403 1:67108298-67108320 CTGTGTCCTCACATGGGAGAAGG + Intronic
909449831 1:75785724-75785746 CTGATGGGTCAGGTTGGAGATGG - Intronic
910810180 1:91227679-91227701 CTGATTGGTCAGGTTGGAGATGG + Intergenic
911331112 1:96526682-96526704 CTGATTGGTCAGGTTGGAGATGG - Intergenic
911441175 1:97927490-97927512 CTGTGTCCTCAGATGGCAGAAGG + Intergenic
911592852 1:99767777-99767799 CTAATTGGTCAGATTGGAGATGG + Intergenic
912500103 1:110116055-110116077 GTGTTTCCTCACATTGCAGAAGG + Intergenic
912583698 1:110742565-110742587 CTGATTGGTCAGGTTGGAGATGG + Intergenic
913289883 1:117262209-117262231 CTGATTGGTCAGGTTGGAGATGG + Intergenic
913335952 1:117709138-117709160 CGGATTGCTCACAGTGGAGAGGG - Intergenic
913487145 1:119341984-119342006 CTGGTTGGTCAGGATGGAGATGG + Intergenic
913595478 1:120371927-120371949 CTGTGTCCTCACATTGCAGAAGG - Intergenic
914091798 1:144507048-144507070 CTGTGTCCTCACATTGCAGAAGG + Intergenic
914306743 1:146426816-146426838 CTGTGTCCTCACATTGCAGAAGG - Intergenic
914595306 1:149145986-149146008 CTGTGTCCTCACATTGCAGAAGG + Intergenic
917704517 1:177618547-177618569 CTGGTTGCTCTGATAAGAGAAGG + Intergenic
917791129 1:178499614-178499636 CTTTTTCCTCAGCTTGCAGATGG + Intergenic
918553593 1:185772836-185772858 CTGTTTTCTCACATGGTAGAAGG + Intronic
919743935 1:200996892-200996914 CTGTGTACTGAGATGGGAGAGGG - Intronic
919827719 1:201515485-201515507 CTAATTGCTCAGGTTGGAGATGG + Intergenic
919847060 1:201648910-201648932 CTGCTTGCGCAGGTTGGAGGCGG - Exonic
920218846 1:204380644-204380666 CTGGTTGCTCAGGTTGGACTGGG - Intergenic
920252803 1:204633143-204633165 CTGTTTCCTCACATGGCAGAAGG - Intronic
920849264 1:209617681-209617703 GTGTTTGTTCTGGTTGGAGAGGG - Intronic
922389091 1:225120182-225120204 CTGATTGGTCAGGTTGGAGATGG + Intronic
923409547 1:233693418-233693440 CTGTTTCTTCAGCCTGGAGATGG - Intergenic
924219993 1:241864521-241864543 CTGTATAGTCAGGTTGGAGATGG + Intronic
1062804462 10:406973-406995 CTGATTGGTCAGGTTGGAGATGG - Intronic
1063221268 10:3970595-3970617 CTGATTGCTCAGGTTGGAGATGG - Intergenic
1063306557 10:4907956-4907978 CTGATTGGTCAGGTTGGAGATGG - Intergenic
1063654821 10:7977726-7977748 CTTTTTGCTCAGATGGCACATGG + Intronic
1065042387 10:21710801-21710823 CTGTTTGCTCATATGTGAAATGG + Intronic
1065679579 10:28215090-28215112 CTGATTGTTCAGGCTGGAGATGG - Intronic
1066089354 10:32002654-32002676 CTGTCTGCACATATTGAAGAGGG + Intergenic
1066114858 10:32230589-32230611 CTGATTGGTCAGGTTGGAGATGG + Intergenic
1066226764 10:33391053-33391075 ATGATTTCTAAGATTGGAGAAGG + Intergenic
1068111349 10:52684292-52684314 CTGATTGGTCAGGTTGGAGATGG + Intergenic
1068400648 10:56523350-56523372 TTGTTTGCACATATTGAAGAGGG + Intergenic
1069558211 10:69411732-69411754 CTGATTGGTCGGGTTGGAGATGG - Intronic
1070057882 10:72953047-72953069 CTGTTTGCACGGATGGGACAGGG - Intronic
1070141714 10:73743072-73743094 CTGATTGGTCAGGTTGAAGACGG + Intergenic
1070234924 10:74613879-74613901 TTGTTGGCTTAGATTGGTGATGG + Intronic
1071186684 10:83054348-83054370 CTGATTGGTCAGGTTGGAGATGG - Intergenic
1071511879 10:86267202-86267224 CTGTTTCCTCAAATTGAAGTTGG - Intronic
1071513742 10:86283284-86283306 CTATTTGCACAGGTTGGGGAGGG + Intronic
1071936094 10:90531862-90531884 CTGATTGGTCAGGTTGGAGATGG + Intergenic
1072970419 10:100012354-100012376 CTGATTGGTCAGGTTGGAGATGG + Intergenic
1072973398 10:100037144-100037166 CTGATTGGTCAGGTTGGAGATGG - Intergenic
1073821611 10:107270873-107270895 CTGTGTTCTCACATGGGAGAAGG + Intergenic
1074485725 10:113876712-113876734 TTGTTTTCTTTGATTGGAGAGGG + Exonic
1075256865 10:120932281-120932303 CTGTGTGTTCAGATGGGAGCTGG - Intergenic
1075975736 10:126692453-126692475 CTGATTGGTCAGGTGGGAGATGG + Intergenic
1076103348 10:127800326-127800348 CTTTTTCCTCAGCTTGCAGATGG + Intergenic
1076190716 10:128481568-128481590 CTGCTCGCTCAAACTGGAGAGGG - Intergenic
1076643567 10:131935632-131935654 CTGTTTTCTCTGATTTGGGATGG + Intronic
1076710066 10:132328239-132328261 CTGATTGGTCAGGTTGGAGATGG + Intronic
1078118346 11:8479533-8479555 CTGGTTGCTTATAATGGAGAGGG - Intronic
1079583664 11:22097949-22097971 CTGTTTTCTCTGACTGCAGATGG - Intergenic
1079764126 11:24369415-24369437 GTGTTTACTCACATTGGGGAAGG - Intergenic
1079819149 11:25103470-25103492 CTGTTTCCTCACATTGAAGAAGG - Intergenic
1080844565 11:36015396-36015418 CTGGTTGCTCAGGCTGTAGAAGG + Intronic
1081107049 11:39083580-39083602 CTGGTTCCTCAGCTTGCAGATGG - Intergenic
1081557298 11:44176844-44176866 GAGCTTGCTCAGACTGGAGAAGG + Intronic
1083050568 11:59772594-59772616 CTGTTTGAACAGCATGGAGAAGG + Intronic
1083401855 11:62428934-62428956 CTGATTGGTCAGGCTGGAGATGG + Intergenic
1084405861 11:68972770-68972792 CTGATTGGTCAGGCTGGAGATGG + Intergenic
1085032978 11:73283836-73283858 CATTTTGCTCAGATGAGAGAGGG + Intronic
1086535177 11:87835687-87835709 CTGTTTCTTCAGCTTGTAGATGG - Intergenic
1086576056 11:88340093-88340115 CTGATTGGTTAGGTTGGAGATGG + Intergenic
1087431906 11:98065968-98065990 CTGATTGGTCGGGTTGGAGATGG - Intergenic
1087870503 11:103288001-103288023 CTGATTGGTCAGGTTGGAGATGG + Intronic
1087870649 11:103289142-103289164 CTGATTGGTCACATTGGAGATGG - Intronic
1087886953 11:103492957-103492979 CTGTTTGATCAGGTTGAAGATGG + Intergenic
1087978141 11:104575909-104575931 CTGTGTTCTCAGAGGGGAGAAGG - Intergenic
1088008039 11:104965982-104966004 CTGATTACTCAGGTGGGAGATGG - Intronic
1088221742 11:107577240-107577262 CTGATTGGTCAGGGTGGAGATGG - Intergenic
1088319277 11:108538474-108538496 GTGTTTGCTCAGAATGTATAAGG - Intronic
1088809870 11:113385048-113385070 TTGTTTGGGCAGATTGAAGATGG - Intergenic
1088937733 11:114420455-114420477 CTGTATTCTCACATTGCAGAAGG - Intronic
1089645049 11:119873510-119873532 CTGTTTGCTGAGGTTGGAGGGGG + Intergenic
1089703522 11:120260280-120260302 CTGTTGGCTCATCTTGGAGGTGG + Intronic
1089833131 11:121346619-121346641 CTGATTGATCAGGTTGGAGATGG - Intergenic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1090961885 11:131564407-131564429 CTGTGTGCTCACATAGTAGAGGG + Intronic
1092476190 12:8820966-8820988 CTGATTGCTCAGGTTGGAGATGG - Intergenic
1092477581 12:8832107-8832129 CTGATTGGTCAGGTTGGAGATGG + Intronic
1092673212 12:10886435-10886457 CTGATTGCTGACATTGGAGCAGG - Intronic
1092676519 12:10927096-10927118 CTGATTGTTGACATTGGAGAAGG + Intronic
1092708816 12:11312370-11312392 CTCATTGCTGACATTGGAGAAGG - Intergenic
1092776018 12:11945870-11945892 CTGTCTGCTCAGAGTGCAGAAGG + Intergenic
1092893445 12:12990968-12990990 CTGATTGGTCAGGTTGGAGATGG - Intronic
1093101816 12:15037438-15037460 CTGATTGGTCAGGTTGGAGATGG + Intergenic
1094212149 12:27904045-27904067 CTGATTGGTCAGGTTGGAGATGG + Intergenic
1095898193 12:47301590-47301612 CTGATTGGTCAGGTTGAAGATGG + Intergenic
1097424562 12:59427523-59427545 CTGTGTCCTCACATGGGAGAAGG + Intergenic
1098729252 12:74011990-74012012 CTGATTGGTCAGGTTGGTGATGG - Intergenic
1098864703 12:75748440-75748462 CTGATTGGTCAGGTTGGAAATGG - Intergenic
1102565221 12:113792840-113792862 ATGTTTGCTGAGAATGGAGCTGG - Intergenic
1103215651 12:119199602-119199624 CTGATTGGTCAGGTTGGAAATGG + Intronic
1103596746 12:122028904-122028926 CTGATTGCTCAGAATTGAGGAGG + Intronic
1103876546 12:124131903-124131925 CTGATTGGCCAGACTGGAGATGG - Intronic
1104364930 12:128168202-128168224 CTGATTGGTCAGGTTGGAGATGG - Intergenic
1105298455 13:19111871-19111893 CTGATTGGTCAGGTTGGAGATGG - Intergenic
1106542338 13:30701098-30701120 CTGATTGGTCAGGTTAGAGATGG - Intergenic
1106768346 13:32938503-32938525 CTGTGTTCTCAGACCGGAGAAGG - Intergenic
1106931832 13:34674711-34674733 CTGATTGGTCAGGTTGGAGATGG - Intergenic
1107307146 13:39034980-39035002 CTATTTGCTCAGCTTAGAGATGG + Intronic
1108134402 13:47339625-47339647 CTGATTGGTCAGGTTGTAGATGG - Intergenic
1109053734 13:57518822-57518844 ATGGTTGCTCAGCTTGGAAAAGG - Intergenic
1110076810 13:71256238-71256260 CTGTGTGCTCACATGGCAGAAGG + Intergenic
1110300497 13:73920985-73921007 CTGTTTGATGAGATTTTAGAAGG - Intronic
1110372418 13:74754824-74754846 CTGTCTTATCAGATAGGAGAGGG + Intergenic
1110571915 13:77013617-77013639 CTGATTGGTCAGTTTGGAGATGG - Intronic
1111249625 13:85586422-85586444 CTGATTGGTCAGGTTGGAGATGG + Intergenic
1112884031 13:104147007-104147029 CTGTGTGCTCACATGGTAGAAGG + Intergenic
1112884949 13:104158822-104158844 CTGTTTCCTTAGATGGTAGAAGG + Intergenic
1115229147 14:31139390-31139412 CTGTGTTCTCACATTGTAGAAGG - Intronic
1116585436 14:46697413-46697435 CTGATTGGTCAGGTTGGAGATGG - Intergenic
1117202518 14:53406777-53406799 CTGTGTCCTCAGATGGCAGAAGG - Intergenic
1117632475 14:57708274-57708296 CTGATTGGTCAGGTTTGAGATGG - Intronic
1118148056 14:63162104-63162126 CTGTGTCCTCACATTGGGGAAGG - Intergenic
1118198224 14:63648105-63648127 CTGATTGGTCAGGTTGGGGATGG + Intergenic
1118643869 14:67818769-67818791 CTGATTGGTCAGGTTGGAGATGG - Intergenic
1118941514 14:70343991-70344013 CTGATTGGTCAGTTTGGAGTTGG + Intronic
1119000216 14:70875026-70875048 CTGATTGGTCAGGTTGGAGATGG + Intergenic
1119023535 14:71135129-71135151 CTGATTGGTCAGGTTGGAGATGG - Intergenic
1119127869 14:72144981-72145003 ATGATTGGTCAGGTTGGAGATGG + Intronic
1119233318 14:72998452-72998474 CTGTTTGCTAAGGGTGGAGGTGG - Intronic
1119504627 14:75161888-75161910 CTGGTTGCTTTTATTGGAGAAGG - Intronic
1120111768 14:80565320-80565342 CGGATTGGTCAGGTTGGAGATGG - Intronic
1120225509 14:81787030-81787052 CTGATTCGTCAGGTTGGAGATGG - Intergenic
1121979403 14:98441549-98441571 CTGTTTTCTCACATGGCAGAAGG + Intergenic
1122047756 14:99035785-99035807 CCGTTTGCTCACATTGGAAATGG - Intergenic
1122273995 14:100581836-100581858 CTGTCTGCTGGGATTGGAGCAGG + Intronic
1123478314 15:20608484-20608506 CTGATTGATCAAGTTGGAGATGG - Intergenic
1123639700 15:22391901-22391923 CTGATTGATCAAGTTGGAGATGG + Intergenic
1123842982 15:24268250-24268272 CTGATTGGTCAGATCAGAGATGG - Intergenic
1123858019 15:24434322-24434344 CTGATTGGTCAGATCAGAGATGG - Intergenic
1124495835 15:30186305-30186327 CTGTGTCCTGAGATTGGGGAGGG - Intergenic
1124747739 15:32352342-32352364 CTGTGTCCTGAGATTGGGGAGGG + Intergenic
1125181041 15:36880882-36880904 CTGTCTGCTCAGTTAGGAGGGGG + Intergenic
1127140975 15:55976606-55976628 ATTTTTGCCCAGATTGGATAAGG - Intronic
1127290402 15:57565434-57565456 CTGTTTGCTCACATCGCGGAGGG + Intergenic
1127660904 15:61099212-61099234 CTGTTTACTCAGATTGGAATGGG + Intronic
1127906985 15:63383073-63383095 CTGATTGGTCAGGTTGCAGATGG + Intergenic
1129339663 15:74877204-74877226 CTGATTGGTCGGGTTGGAGATGG - Intergenic
1129377178 15:75141183-75141205 CTGATTGGTTAGGTTGGAGATGG - Intergenic
1129670984 15:77607587-77607609 CTGATTGCTCAGCCTGGAAAGGG - Intergenic
1129847200 15:78773386-78773408 CAGTTTCCTCAGATGTGAGACGG + Intronic
1129943224 15:79516737-79516759 CAGGTTTCTCAGATAGGAGAAGG - Intergenic
1130284642 15:82544773-82544795 CTGCTTGTTCTGTTTGGAGAAGG + Intronic
1130756595 15:86770883-86770905 CTGTGTGCCCAGGTTTGAGAAGG - Intronic
1132742537 16:1422324-1422346 CTGGTTGGTCAGGTTGGAGATGG - Intergenic
1133362336 16:5184404-5184426 CTGATTGGTCAGGTTGGAGATGG + Intergenic
1133625168 16:7564221-7564243 CTGTGTTCTCAGATGGAAGAGGG - Intronic
1133841229 16:9411536-9411558 CTGATTGGTCAGGTTGGAGATGG - Intergenic
1134740614 16:16540446-16540468 CTGATTGGTCAGGTTGGAGATGG - Intergenic
1134926888 16:18171726-18171748 CTGATTGGTCAGGTTGGAGATGG + Intergenic
1135279682 16:21143376-21143398 CTGCATGCTCACATGGGAGAAGG - Intronic
1135751449 16:25061850-25061872 CTGTTTGCTAAGTTGGGAGGTGG + Intergenic
1135809775 16:25576623-25576645 CAGATTGGTCAGATTGGAGATGG + Intergenic
1136627177 16:31468741-31468763 CTTTTTGCTCACATTGGACTGGG + Intergenic
1136924401 16:34358534-34358556 CTGATTGATCAGATCAGAGATGG - Intergenic
1136980172 16:35053272-35053294 CTGATTGATCAGATCAGAGATGG + Intergenic
1137014562 16:35362231-35362253 ATGTTTACTCAGACTGAAGACGG - Intergenic
1137240415 16:46651037-46651059 CTGATGGTTCAGGTTGGAGATGG + Intergenic
1137452523 16:48590259-48590281 CTGATTGGTCAGGTTGGAGATGG - Intronic
1137453246 16:48597045-48597067 CTGATTGGTCAGGTTGGAGATGG - Intronic
1138006504 16:53342553-53342575 CTGATTGGTCAGGCTGGAGATGG - Intergenic
1138459417 16:57139179-57139201 CTGATTGGTCAGGCTGGAGATGG + Intronic
1138612581 16:58138427-58138449 CTGTTTCCACACATTGCAGAAGG - Intergenic
1138744928 16:59352481-59352503 CTGATTGGTCAGGTTGAAGATGG + Intergenic
1139129810 16:64129038-64129060 CTCTTTGCTTAGATTGAAAAAGG + Intergenic
1141262737 16:82468519-82468541 CTGATTGGTCAGGTTGGAGATGG + Intergenic
1141500741 16:84442666-84442688 CTGTTAGCTCAGACAGGAGCTGG - Intronic
1141917482 16:87109619-87109641 CTGATTGGTCAGGTTGGAGATGG + Intronic
1141955438 16:87367873-87367895 ATCTTTGCTCAGATTGCTGAAGG + Intronic
1142308899 16:89300672-89300694 CTGGTGCCTCAGATAGGAGACGG - Intronic
1142392170 16:89808793-89808815 CTGTTTTATCAAATGGGAGAGGG - Intronic
1143466736 17:7142087-7142109 CTGACTGGTCAGGTTGGAGACGG - Intergenic
1143657247 17:8302523-8302545 CTGATTGGTCAGGTTGGAGATGG + Intergenic
1146698096 17:34927194-34927216 CTGTTTGTGCATATAGGAGAAGG - Intergenic
1148438282 17:47698677-47698699 CGGTGGGCTCAGGTTGGAGAAGG - Exonic
1149103741 17:52937291-52937313 CTGATTGGTCAGGTTGGAGACGG - Intergenic
1149426550 17:56560024-56560046 CTGGTTGTTCAGTTTGCAGATGG + Intergenic
1149991801 17:61387651-61387673 CTGTTGGCTCATATTGGAAATGG - Intronic
1151597207 17:75085854-75085876 CTGATTGGTCAGGTTGGAGATGG - Intergenic
1152114124 17:78374481-78374503 CTGATTGGTCAGGTTGGAGATGG - Intergenic
1152943014 17:83182259-83182281 CTGTTTGCTGGGATGGGTGAGGG + Intergenic
1153214346 18:2805517-2805539 CTGCTTGCTGAGCTTGGAGGTGG - Intergenic
1155211918 18:23609340-23609362 CTGATTGGTCAGATTGGAGATGG - Intronic
1155712157 18:28895846-28895868 CTTTTTGCTCAGATTTGATTTGG - Intergenic
1155932214 18:31719727-31719749 CCGTTTGATCAGGTAGGAGATGG + Intergenic
1156301576 18:35841040-35841062 CTGACTGGTCAGGTTGGAGATGG - Intergenic
1156411318 18:36830078-36830100 GTGTTTGCTAGGATTGGTGATGG + Intronic
1156473861 18:37393760-37393782 GAGATTGCTCAGATTGGGGATGG - Intronic
1157207177 18:45710511-45710533 CTGTTTCCTCAGCTTGTAAAAGG + Intergenic
1158396220 18:57080146-57080168 CTGTGTGCTCACATGGCAGAAGG - Intergenic
1158437964 18:57447311-57447333 CTGTTTGAGCGAATTGGAGATGG + Intronic
1159462693 18:68740901-68740923 CAGTTTGCTCAGCATGGAGAAGG + Intronic
1159851746 18:73533753-73533775 CTGGTTGTTCATGTTGGAGATGG - Intergenic
1161269365 19:3381467-3381489 CTGTTTGCTCATCTGGGCGATGG + Intronic
1161630489 19:5352611-5352633 CTGTTTGCTCAACTTTCAGAAGG - Intergenic
1161853178 19:6749389-6749411 CTGTTTGCTTATTTTGGAAATGG - Intronic
1163727811 19:18932491-18932513 CTGATTGCTGAGCTTGGGGATGG + Intronic
1165277075 19:34763545-34763567 CTGTCTTCTCAGCTTGCAGATGG - Intronic
1166487478 19:43225695-43225717 CTGTTTGCTGACATGGGACAGGG - Intronic
1166921112 19:46229833-46229855 GTGGTGGCTGAGATTGGAGATGG - Intronic
1167064855 19:47177536-47177558 CTGTTTGTACAGATTGGGGCAGG + Intronic
1167212303 19:48140791-48140813 CTGATTGGTCAGGTTGAAGATGG - Intronic
1167256944 19:48436259-48436281 CTGATTGGTCAGGTTGGAGTTGG + Intronic
1167389853 19:49187812-49187834 CTGATTGGTCAGGTTGGAGATGG + Intronic
1167613383 19:50517907-50517929 CTGCTTGCGCAGCTTGTAGAAGG + Exonic
1167678581 19:50905257-50905279 CTGGTTGCTGGGATGGGAGAGGG - Intergenic
925604167 2:5641282-5641304 CTGTGTCCTCACATTGCAGAAGG - Intergenic
926408234 2:12575291-12575313 CTGTTTTATCAGATTTGGGAAGG - Intergenic
929111963 2:38412496-38412518 CTGATTGGTCAGGTTGGAAATGG - Intergenic
929321107 2:40544419-40544441 CTGGCTGGTCAGGTTGGAGATGG + Intronic
929934379 2:46283904-46283926 CTTGTTGGTCAGATTGGAGGTGG + Intergenic
930065837 2:47326907-47326929 CTGATGGATCAGGTTGGAGATGG + Intergenic
930302781 2:49638225-49638247 CTGATTGGTCAGGTTTGAGATGG - Intergenic
930922471 2:56773759-56773781 CTGTTTGCTCCTGGTGGAGATGG + Intergenic
932338510 2:70944423-70944445 CAGTTTGCTCAGCTAGGAGGTGG - Intronic
933511813 2:83249434-83249456 CTGATTGGTCAGGTTGCAGATGG + Intergenic
933657925 2:84905018-84905040 CTCTTTGCTCAGGTTGGGGGCGG - Intronic
934144800 2:89081258-89081280 ATGTGGGCTCAGGTTGGAGAAGG + Intergenic
934224457 2:90119293-90119315 ATGTGGGCTCAGGTTGGAGAAGG - Intergenic
936170624 2:110169430-110169452 CTGTTAGCTTAGATATGAGAGGG - Intronic
936672058 2:114668167-114668189 CTGTTTCTTCAGCTTGTAGATGG - Intronic
937055408 2:118930900-118930922 CTGTGTGCTCACATGGCAGATGG + Intergenic
937153472 2:119701823-119701845 CTGATTGGTCAGATTGGAGAGGG + Intergenic
937691198 2:124757333-124757355 CTGTGTGCACAGAATGGGGATGG + Intronic
939726530 2:145727462-145727484 CTGATTGGTCAGGTTGGGGATGG - Intergenic
939844751 2:147229467-147229489 CTGATTTGTCAGGTTGGAGATGG - Intergenic
940707771 2:157126039-157126061 CTGATTGATCAGGTTGGAGATGG - Intergenic
942314427 2:174684261-174684283 CTGATTGACCAGGTTGGAGATGG - Intergenic
943489997 2:188540076-188540098 GTGTTTTATAAGATTGGAGATGG - Intronic
943862668 2:192888834-192888856 CTGACTGGTCAGGTTGGAGATGG + Intergenic
944211482 2:197210893-197210915 CTGTTTGGTGGTATTGGAGAGGG + Intronic
944646900 2:201789163-201789185 CTGACTGGTAAGATTGGAGATGG + Intergenic
944898108 2:204186584-204186606 CTCTTTGCTCAGAGAGGTGAAGG - Intergenic
945036349 2:205707150-205707172 CTGTTCTCTCAGAATGGAAAGGG + Intronic
945392366 2:209279672-209279694 CTGGTTGGTCAGGTTGGATATGG - Intergenic
946145199 2:217725374-217725396 CTGTTTGCTGAGCTGGAAGAGGG - Intronic
946765593 2:223037150-223037172 CTGATTGGTCAGCTTGGAGATGG + Intergenic
947160400 2:227208530-227208552 CTGACTGGTCAGGTTGGAGATGG - Intronic
947216287 2:227753188-227753210 CTGATTGGTCAGGTTGGAGATGG - Intergenic
947514621 2:230791244-230791266 CTGTTTCATCACATTGGACATGG + Intronic
947807961 2:232981646-232981668 CTGATTGATCAGGTTGGAGATGG - Intronic
948127540 2:235575834-235575856 CTCTTTACTGAGATTGGGGAGGG + Intronic
948302387 2:236917470-236917492 CTGATTGGTCAGGTTGGAGATGG + Intergenic
948784207 2:240342976-240342998 ATGTGTGCTCTGATTGGTGAAGG - Intergenic
1168881421 20:1209408-1209430 CTATCTTCCCAGATTGGAGATGG - Intergenic
1169302484 20:4456270-4456292 CTGATTGGTCAGGTTTGAGATGG - Intergenic
1169952493 20:11060885-11060907 CAGTTTGCTAACATTAGAGAGGG - Intergenic
1169956191 20:11105587-11105609 ATGTTTGCGGAGAATGGAGAAGG + Intergenic
1172250361 20:33475218-33475240 CTGTTTGCTCAAATTGTGCATGG - Intergenic
1172997447 20:39081781-39081803 CAGCTTCCTCAAATTGGAGATGG - Intergenic
1173295424 20:41751140-41751162 CTATGTGCTCACATAGGAGAAGG - Intergenic
1173600946 20:44294772-44294794 CTGATGGGTCAGGTTGGAGATGG + Intergenic
1173746943 20:45444775-45444797 CTGATTGGTCAGGTTGGAGATGG + Intergenic
1174147384 20:48461417-48461439 CTGATTGGTCAGGTTGGAGATGG + Intergenic
1174537104 20:51259759-51259781 CTGATTAGTCAGGTTGGAGATGG - Intergenic
1176132300 20:63501359-63501381 CTGTGTCCTCACATGGGAGAAGG - Intergenic
1176416757 21:6480208-6480230 CTGTTTGCTAATATTGGATGTGG + Intergenic
1177464585 21:21458562-21458584 CTTTTTCCTCACATTGCAGAAGG - Intronic
1179692255 21:43088543-43088565 CTGTTTGCTAATATTGGATGTGG + Intergenic
1180106196 21:45619656-45619678 CTGATTGGTCAGGCTGGAGATGG + Intergenic
1181112135 22:20608447-20608469 CTGGTTGCTCAGCATTGAGAGGG + Intergenic
1181640807 22:24197260-24197282 CTGATTGGTCAGGTTGGAGGTGG - Intergenic
1182559703 22:31150161-31150183 CTGATTGGTCAGGTTGGAGATGG - Intergenic
1183140009 22:35928621-35928643 CTGTTTTCTTTTATTGGAGAAGG + Intronic
1183872639 22:40752075-40752097 CTGATTGATCAGGTTGGAGATGG - Intergenic
1184416294 22:44353629-44353651 CTGCTTGCTGAGAATAGAGAGGG - Intergenic
1184904599 22:47472527-47472549 CTGATTGGTCAGGTTGGAGATGG - Intronic
1184970281 22:48015094-48015116 CTTTCTGCTCACATCGGAGAAGG + Intergenic
1185014427 22:48334867-48334889 CTGTTTGCTCATCATAGAGATGG + Intergenic
949613421 3:5727808-5727830 CTGATTAGTCAGGTTGGAGATGG + Intergenic
949620928 3:5810791-5810813 TTGATTGCTATGATTGGAGAAGG - Intergenic
950482872 3:13255346-13255368 CTGTTGCCCCAGGTTGGAGAGGG - Intergenic
950921097 3:16695667-16695689 GTGATTGGTCAGGTTGGAGATGG - Intergenic
951205565 3:19922737-19922759 CAATTTGCTCACAATGGAGATGG + Intronic
951263514 3:20540115-20540137 CTGATTGTTCAGGTTGGAGATGG + Intergenic
952212184 3:31239210-31239232 CTCTTTGCTCAAGGTGGAGAAGG - Intergenic
952767319 3:36965533-36965555 CTGATTGGTCAGGTTAGAGATGG + Intergenic
952968361 3:38635133-38635155 CTGATTGCTCACAGTGGAGAGGG - Intronic
953069788 3:39507698-39507720 CTGTTTCCTTTCATTGGAGAAGG - Intronic
953212087 3:40885008-40885030 CTGATTGGTCAAGTTGGAGATGG + Intergenic
953492961 3:43365392-43365414 CTGTTTGCTGGGAAAGGAGAGGG - Intronic
955070883 3:55571637-55571659 CTGTTTGGTCAGAAAGCAGAGGG - Intronic
955329633 3:58036414-58036436 CTGATTGGTCAAGTTGGAGATGG + Intronic
955391409 3:58524856-58524878 CTGTTTGCTCAGATCACAGAAGG - Intronic
956084516 3:65595939-65595961 CTGTTTGCTCAGTTGAGAAATGG + Intronic
956351429 3:68341258-68341280 CTGGTTGGTCGGGTTGGAGATGG + Intronic
958487359 3:94729798-94729820 CTTTTTCCTCAGCTTGTAGATGG - Intergenic
959577557 3:107950604-107950626 CTGTTTCTTCAGCTTGCAGATGG + Intergenic
960531515 3:118771038-118771060 CTGGTTCCTCAGCTTGCAGACGG - Intergenic
960877210 3:122309220-122309242 CTGATTGGTCAGGTTGGAGATGG - Intergenic
962094178 3:132276608-132276630 CTGATTGGTCAGGTTGGAGATGG + Intronic
962467482 3:135673874-135673896 CTGTGTGCTCACATGGCAGAAGG + Intergenic
963470496 3:145735713-145735735 TTGTTTGGTCAGGTTGGAGATGG + Intergenic
964414203 3:156430578-156430600 CTGTTTTCTCACAATGGAGCTGG - Intronic
964866555 3:161268890-161268912 CTGATTGGTCAGATTGGAGATGG - Intergenic
964899219 3:161637666-161637688 ATGATTGGTCAGGTTGGAGATGG + Intergenic
966355206 3:179072034-179072056 CTGTCTGCTGAGATTGGCGGCGG - Exonic
966410635 3:179642842-179642864 CTGCTTGCTGAGCTTGGGGATGG - Intergenic
969303798 4:6313489-6313511 CTGATTGGTCAGGTTGGAGATGG - Intergenic
970235108 4:13950779-13950801 CTGATTGGTTAGGTTGGAGATGG - Intergenic
970528918 4:16962399-16962421 ATGATTGATCAGGTTGGAGATGG + Intergenic
970766247 4:19552208-19552230 CTGTCTGCTTAGCTTGCAGATGG - Intergenic
970875414 4:20863242-20863264 CTGATTCGTCAGTTTGGAGATGG + Intronic
971072159 4:23106231-23106253 CTGGGTCCTCAGATTGCAGAGGG + Intergenic
971072912 4:23114701-23114723 CTGTTTCTTCAGATTTGAAAAGG + Intergenic
972195268 4:36646381-36646403 CTGATTGGTCAGGTTGGAGATGG + Intergenic
972228700 4:37045007-37045029 CTGATTGGTCAGGTTGGAGATGG + Intergenic
974395667 4:61331524-61331546 ATGTTTGCTCAGTTTGTAAAAGG + Intronic
975293520 4:72705558-72705580 CTGATTGGTCAGGTTGGAGATGG - Intergenic
975707198 4:77122888-77122910 CTGATTACTCAGGTAGGAGATGG - Intergenic
975925283 4:79443885-79443907 CTTTCTCCTCAGATTGCAGATGG - Intergenic
975974777 4:80082195-80082217 CTGTGTCCTCAGATGGCAGAAGG + Intronic
976278868 4:83307051-83307073 CTGGTTGGTCAGGTTGGAGATGG - Intronic
976901639 4:90184676-90184698 GTGTTTGCTCAGCCTGCAGATGG + Intronic
977926223 4:102703736-102703758 CTGATTGATCAGGTTGGAGATGG - Intronic
978606593 4:110486951-110486973 CTGATTGGTCAAGTTGGAGATGG + Intronic
978698091 4:111607591-111607613 CTGTGTCCTCACATTGCAGAAGG + Intergenic
978744475 4:112176067-112176089 CTGTTTACTCACTTTGGAAAGGG - Intronic
980252383 4:130334776-130334798 CTGATTGGTCAGGTTGGAGACGG + Intergenic
980380597 4:132010378-132010400 CTGTTTTCTCACATAGCAGAAGG - Intergenic
980831826 4:138138707-138138729 CTGTTTCTTCAGATTGTTGAGGG + Intergenic
980972626 4:139581192-139581214 CTGATTGGTCAGGTTGGAGATGG + Intronic
981015979 4:139974893-139974915 CTGTTTACTAAGAGTGCAGAGGG + Intronic
982237783 4:153268020-153268042 CTGACTGGTCAGGTTGGAGATGG + Intronic
984091537 4:175381133-175381155 CTGATTGGTCCGGTTGGAGATGG - Intergenic
984255868 4:177389211-177389233 GAGTTTGCTCAGATATGAGAGGG - Intergenic
984257301 4:177404084-177404106 CTGATTGGTCAGGTTGGAGATGG + Intergenic
986374669 5:7117826-7117848 CTGTGTCCTCAGATAGCAGAAGG - Intergenic
987989613 5:25193453-25193475 CTGTTTCCTCAGCTTGCAGATGG + Intergenic
987993485 5:25245697-25245719 CTTTTTCCTCAGCTTGCAGATGG + Intergenic
988673297 5:33405444-33405466 CTGTGTCCTCAGATAGTAGAAGG - Intergenic
989159228 5:38374403-38374425 CTGATTGGTCAGGTTGGAGATGG + Intronic
989976057 5:50588528-50588550 CTGTTTGGTCAGGTTGGAGATGG + Intergenic
990374292 5:55153902-55153924 CTGTTTGCTCATATTGTAGTGGG - Intronic
990522616 5:56594610-56594632 ATCTCTGCTCAGCTTGGAGAAGG + Intronic
991689797 5:69214912-69214934 CTGTGTGCTCACATGGCAGAAGG - Intergenic
992009498 5:72512528-72512550 CTGATTGGTCAGGTTGGAGATGG + Intergenic
992286625 5:75242166-75242188 CTGAGTGGTCAGGTTGGAGATGG + Intergenic
992948112 5:81829459-81829481 CTGTCTTCTCAGCTTGCAGATGG + Intergenic
993164584 5:84335927-84335949 CTGTTTCCTCAGATGGAGGAAGG + Intronic
993272862 5:85817437-85817459 CTGATTGGTCAGGTTGGAGATGG - Intergenic
994034650 5:95184901-95184923 CTGATTGGTCAGGTTGGAGATGG - Intronic
994448105 5:99903598-99903620 CTGTATTCTCATATGGGAGAAGG - Intergenic
995710167 5:115027198-115027220 CTGGTTCCTCAGCTTGCAGATGG - Intergenic
996231924 5:121075202-121075224 CTGTGTGCTCACATGGTAGAAGG + Intergenic
996690246 5:126332881-126332903 CTGTATGCTAAGTATGGAGAAGG - Intergenic
996832626 5:127756419-127756441 CTGGTTGGTCAGGTTGGAGATGG + Intergenic
996919115 5:128746936-128746958 CTGATTGGTGAGGTTGGAGATGG + Intronic
997523301 5:134536990-134537012 CTGTTTGCTCAGTTTGGCTCTGG + Intronic
998002941 5:138639125-138639147 CTGTTGCAGCAGATTGGAGAGGG - Intronic
999405283 5:151301538-151301560 CTGATTGATCAGGTTGGAGATGG - Intronic
999545748 5:152626446-152626468 CTCTTTCCTCAGCTTGCAGAGGG + Intergenic
999886680 5:155931954-155931976 CTGTGTGCTCACATGGTAGAAGG + Intronic
1000028375 5:157380007-157380029 CTGATTGATCAGGTTGGAGATGG + Intronic
1001909297 5:175502021-175502043 CTGGTTGGTCAGGTTGTAGATGG + Intronic
1004587032 6:17012603-17012625 CTGTGGGATCTGATTGGAGACGG + Intergenic
1005624152 6:27647662-27647684 CTGATTGGTCGGGTTGGAGATGG - Intergenic
1006078372 6:31548951-31548973 CTGTTTCCTCAGCTGGGAAATGG - Intronic
1006298903 6:33182928-33182950 CTGTTTGGTCAGAATGAAGGTGG - Intronic
1006869023 6:37233473-37233495 CTGCATGCTCACATGGGAGAAGG + Intronic
1008504044 6:52211851-52211873 CTGATTGGTCAGGTTGGAGATGG - Intergenic
1009901537 6:69813029-69813051 CTGATTGGTCAGGTTGGAGATGG - Intergenic
1009949671 6:70381033-70381055 CTGATTGGTCAGGTTGGAAATGG - Intergenic
1010637496 6:78279445-78279467 CTGATTGGTCAAGTTGGAGATGG - Intergenic
1011564388 6:88658962-88658984 CTGGTTCCTCAGCTTGCAGACGG + Intronic
1013532620 6:111034012-111034034 CTGATTGGTCAGGTTGGAGATGG + Intergenic
1014919631 6:127198415-127198437 GTTTTTGCTCAAATTTGAGAAGG - Intergenic
1015078284 6:129190949-129190971 CTCTTTGCACAGATTTGAAAAGG - Intronic
1016219612 6:141651578-141651600 TTGTTTGCTCAGAGTGAACATGG - Intergenic
1017185260 6:151594307-151594329 CTGTTTCCTCATATTTAAGATGG + Intronic
1017341604 6:153330656-153330678 CTGTATGTTCAGATGGAAGATGG + Intergenic
1017778589 6:157698844-157698866 CTGATTGGTCAGGTGGGAGATGG + Intergenic
1017795731 6:157842622-157842644 CTGATTGGTCAGGTTGCAGATGG + Intronic
1019226318 6:170512882-170512904 CTGTTTGGTGAGATTGGTGGGGG + Intergenic
1020267263 7:6569361-6569383 CTGATTGGTCAGGTTGGAGATGG + Intergenic
1021180349 7:17498591-17498613 CTGATTGGTCAGGTTGGAGATGG + Intergenic
1021387810 7:20053427-20053449 CTGATTGGTCAGGTTGGAGATGG - Intergenic
1022014620 7:26338759-26338781 CTGATTGGTCAGGTTGGAGATGG + Intronic
1022224198 7:28346351-28346373 CTGTATCCTCACATGGGAGAAGG + Intronic
1022558568 7:31325519-31325541 CTGTCTGCTCAGCTTGGGCAGGG - Intergenic
1022649486 7:32261367-32261389 CTGATTGGTCAGGTTGGAGATGG - Intronic
1024199282 7:47090016-47090038 GTGTTTGCTCATAGTGGAAAAGG - Intergenic
1024315887 7:48016216-48016238 CTGATTGGTCAGGTTGGAGATGG - Intronic
1024325408 7:48105711-48105733 CTGTGTGCTCACATGGCAGAAGG + Intronic
1024770380 7:52714829-52714851 CTGATCGGTCAGGTTGGAGATGG + Intergenic
1025029899 7:55548456-55548478 CTGTTTTCTCACATTAGAGCTGG + Intronic
1025224295 7:57143280-57143302 ATGTTTGCTCAGACTGGAGGTGG + Intergenic
1025745363 7:64238165-64238187 ATGTTTGCTCAGACTGGAGGTGG - Intronic
1026110914 7:67458419-67458441 CTGATTGGTCAGGTTGGAGATGG - Intergenic
1026126688 7:67585752-67585774 CTGATTGGTCAGATTGGAGGTGG - Intergenic
1026142873 7:67721220-67721242 TTGATTGGTCAGGTTGGAGATGG + Intergenic
1026899844 7:74030787-74030809 CTGCTTGCTTTGGTTGGAGAGGG + Intronic
1027552440 7:79616188-79616210 CTGATTGATCAGGTTGGCGATGG - Intergenic
1028423348 7:90658359-90658381 CTGTATACTCAGATGGTAGAAGG + Intronic
1029678517 7:102090772-102090794 ATGTTTACTCAGATTTGAGTTGG + Intronic
1029800446 7:102941379-102941401 CTGATTGGTCAGGTTGGAGATGG - Intronic
1030615798 7:111736961-111736983 CTGTTTAATCATATTGGAGACGG - Exonic
1030619952 7:111778243-111778265 CTTTTGGCTCAGATTGGGAAGGG - Intronic
1030784869 7:113646667-113646689 CTGGTTCCTCAGTTTGCAGATGG - Intergenic
1031740838 7:125428258-125428280 CTGTTCTCACAGACTGGAGAAGG + Intergenic
1031794669 7:126156746-126156768 CTGATTGGTCAGGTTGGAGATGG - Intergenic
1033011320 7:137625605-137625627 CTGTTTGCACAGACTGGGCATGG + Intronic
1033197009 7:139336469-139336491 CTGTTAGCTTTGTTTGGAGATGG - Intergenic
1033327167 7:140389435-140389457 CTGATTGGTCAGGTTGGAGAAGG - Intronic
1035209369 7:157316514-157316536 CTGATTGGTCGGGTTGGAGATGG - Intergenic
1035673232 8:1436156-1436178 CTGGTTCCTCAGCTTGCAGACGG - Intergenic
1035871626 8:3141740-3141762 CTCATTGGTCAGGTTGGAGATGG - Intronic
1036637576 8:10562449-10562471 CTGATTGGTCATGTTGGAGATGG - Intergenic
1036768051 8:11561290-11561312 CTGTTCCCTCAGATTGCTGAAGG + Exonic
1037396976 8:18453517-18453539 CTGATTGGTCAGGTTGGAGATGG - Intergenic
1037465303 8:19153963-19153985 CTGATTGGTCAGATTGGAGTTGG - Intergenic
1038497156 8:28011542-28011564 CTGATTGGTCAGGTTGGAAATGG + Intergenic
1038666612 8:29543060-29543082 CTGATTGGTCAAGTTGGAGATGG - Intergenic
1038978144 8:32724423-32724445 CTGTTTGCTCTGATTGGCATAGG + Intronic
1039234670 8:35488777-35488799 CTGGTTTCACAGATTGGCGATGG + Intronic
1040830834 8:51675339-51675361 CTGTATCCTCAGGTTGCAGAAGG - Intronic
1041726545 8:61023348-61023370 TTGTTTACACAGCTTGGAGACGG + Intergenic
1042076984 8:65007209-65007231 CTGTGTCCTCAGATGGCAGAAGG + Intergenic
1042983632 8:74558348-74558370 CTGACTGATCAGGTTGGAGATGG - Intergenic
1043182075 8:77097419-77097441 CTGATTGGTCAGGTTGGGGATGG + Intergenic
1045057549 8:98382547-98382569 CTGTGTTCTAAGATTGGAGGCGG + Intergenic
1048561085 8:135538221-135538243 CTGCTGGTTCAGATTGAAGATGG + Intronic
1048634923 8:136285370-136285392 CTCTTTGCCCAGCTTGCAGATGG - Intergenic
1050926754 9:11273433-11273455 CTGATTGGTCAGGTTGGAGATGG - Intergenic
1051004934 9:12332300-12332322 CTTGTTCCTCAGCTTGGAGATGG + Intergenic
1051963955 9:22803194-22803216 CTGTTTGCTCACAAGGCAGAAGG + Intergenic
1052190628 9:25657169-25657191 CTGATTGGTCAGGTTGCAGAGGG - Intergenic
1053502437 9:38610272-38610294 CTCTTTGTTCTGATTTGAGAAGG - Intergenic
1053803475 9:41778428-41778450 CTGGTTGGTCCGTTTGGAGATGG - Intergenic
1053872109 9:42503229-42503251 CTGATTGGTCAGGTTGGAGATGG - Intergenic
1053900642 9:42792734-42792756 CTGATTGGTCAGGTTGGAGATGG + Intergenic
1054141788 9:61536696-61536718 CTGGTTGGTCCGTTTGGAGATGG + Intergenic
1054191769 9:61989738-61989760 CTGGTTGGTCCGTTTGGAGATGG - Intergenic
1054261004 9:62864808-62864830 CTGATTGGTCAGGTTGGAGATGG - Intergenic
1054461545 9:65467871-65467893 CTGGTTGGTCCGTTTGGAGATGG + Intergenic
1054646601 9:67597974-67597996 CTGGTTGGTCCGTTTGGAGATGG + Intergenic
1054775288 9:69119969-69119991 CTGATTGGTCAGGTTGGAGATGG - Intergenic
1055410907 9:76028456-76028478 CTGATTGGTCAGGCTGGAGATGG + Intronic
1055860195 9:80741040-80741062 CTAATTGGTCAGGTTGGAGATGG - Intergenic
1056234819 9:84584277-84584299 GTATTTGCTCTGATTGGTGAGGG + Intergenic
1057035336 9:91807863-91807885 CTGTCAGATCAGCTTGGAGAGGG - Intronic
1057707037 9:97402275-97402297 CTGTGTCCTCAGATGGCAGAAGG + Intergenic
1057722715 9:97545855-97545877 CTCTGTGCTCAGACTGGAGTCGG + Intronic
1057992410 9:99784049-99784071 CTGATTGGTCAGGTTGGAGATGG - Intergenic
1059133220 9:111777032-111777054 CTGACTGTTCAGGTTGGAGATGG + Intronic
1059136396 9:111810738-111810760 CTGATTGGTCAGGTTGGAGATGG - Intergenic
1059246207 9:112851785-112851807 CTGATTGGTCAGGTAGGAGATGG + Intronic
1059811902 9:117864594-117864616 GTGTTTGGCCACATTGGAGACGG + Intergenic
1059867992 9:118538061-118538083 CTGTCTCCTCAGCTTGCAGACGG - Intergenic
1060431676 9:123556188-123556210 CTGTGTGCTCACATAGCAGAAGG - Intronic
1061089012 9:128416155-128416177 CTGATTGGTCAGATTGGAGATGG + Intronic
1061648665 9:132027981-132028003 GTGGTTGCTCAGATCAGAGATGG - Intronic
1185776010 X:2803570-2803592 CTGATTGGTCAGGTTGCAGAGGG + Intronic
1186071554 X:5826467-5826489 CTGATTGGTCAGGTTGGAGATGG + Intergenic
1186765117 X:12762892-12762914 CTCTCTGCTCAGCTTGTAGATGG - Intergenic
1187056607 X:15746725-15746747 CTGATTGCTCAGGTTGGAGATGG + Intronic
1187112300 X:16314227-16314249 CTGATTGGTCAGGTTGGAGACGG + Intergenic
1187355817 X:18570497-18570519 CTGGTTGCTCTTATTGAAGAAGG - Intronic
1187365063 X:18659953-18659975 CTGTTTGTTCAGATTCGTGTTGG - Intronic
1187997171 X:24940003-24940025 CTGTTTCTTCAGTTTGGAGAAGG + Intronic
1188121166 X:26309879-26309901 CTGATTGGTTAGGTTGGAGATGG + Intergenic
1188148578 X:26644851-26644873 CTGATTGGTCAGGTTGGAGATGG + Intergenic
1188751166 X:33907257-33907279 CTGATTGGTCAGGTTGGAGATGG - Intergenic
1188871735 X:35381790-35381812 CTGGTTGGTCAGGTTGAAGATGG + Intergenic
1189550661 X:42089130-42089152 CTGATTGGTCAGGTTAGAGATGG - Intergenic
1190010514 X:46780712-46780734 CTCTTTCCTCAGCTTGCAGACGG - Intergenic
1191004427 X:55695960-55695982 CTGATTGGTCAGGTTGGAGATGG + Intergenic
1191127631 X:56974692-56974714 CTGATTGGTCGGGTTGGAGATGG - Intergenic
1192490887 X:71576638-71576660 CAGTTTTCTCAGATATGAGAGGG + Intergenic
1193523572 X:82560548-82560570 CTGATTGGTCAGGTTGGAGATGG - Intergenic
1194294314 X:92109428-92109450 CTGATTGTTCGGATTGAAGATGG + Intronic
1194346701 X:92773863-92773885 GTGATTGCTCAGGGTGGAGAAGG - Intergenic
1194620266 X:96162312-96162334 CTGACTGGTCAGGTTGGAGATGG + Intergenic
1194641560 X:96409090-96409112 CTGATTGGTCAGGTTGGAGATGG - Intergenic
1194648002 X:96482129-96482151 CTGATTGGTCAGGTTGGAGGTGG - Intergenic
1196251872 X:113470266-113470288 CTGATTGGTCAGGTTGGAAATGG + Intergenic
1196321374 X:114344392-114344414 CTGTTTTCTCACATGGCAGAAGG - Intergenic
1196997472 X:121400094-121400116 CTGATTGGTCAGGTTGGAGATGG + Intergenic
1197495326 X:127172665-127172687 CTGGTTCCTCAGCTTGCAGATGG + Intergenic
1197826931 X:130600084-130600106 CTGATTGGTCAGGTTGGAGATGG + Intergenic
1198047025 X:132913365-132913387 CTGTTTGCTCAGGCTGTGGATGG + Intronic
1198565210 X:137897033-137897055 CTGGCTGCTCAGCTTGCAGACGG + Intergenic
1199326328 X:146502671-146502693 CTGTGTCCTCATATTGGAGAAGG + Intergenic
1199376835 X:147122693-147122715 ATGTTTTCTTAGGTTGGAGATGG + Intergenic
1200655034 Y:5890507-5890529 GTGATTGCTCAGGGTGGAGAAGG - Intergenic
1201233307 Y:11886842-11886864 CTTATTGTTCAGGTTGGAGATGG - Intergenic
1201293987 Y:12448131-12448153 CTGATTGGTCAGGTTGCAGAGGG - Intergenic