ID: 906114446

View in Genome Browser
Species Human (GRCh38)
Location 1:43347029-43347051
Sequence ATAGATATACTAGCAGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 712
Summary {0: 1, 1: 0, 2: 0, 3: 58, 4: 653}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906114446_906114448 14 Left 906114446 1:43347029-43347051 CCAGTCTCTGCTAGTATATCTAT 0: 1
1: 0
2: 0
3: 58
4: 653
Right 906114448 1:43347066-43347088 ACTGGTATCTTAGTCTCTCTTGG 0: 1
1: 0
2: 1
3: 16
4: 182
906114446_906114449 15 Left 906114446 1:43347029-43347051 CCAGTCTCTGCTAGTATATCTAT 0: 1
1: 0
2: 0
3: 58
4: 653
Right 906114449 1:43347067-43347089 CTGGTATCTTAGTCTCTCTTGGG 0: 1
1: 0
2: 2
3: 12
4: 177
906114446_906114447 -4 Left 906114446 1:43347029-43347051 CCAGTCTCTGCTAGTATATCTAT 0: 1
1: 0
2: 0
3: 58
4: 653
Right 906114447 1:43347048-43347070 CTATGTTTATCAGATTCAACTGG 0: 1
1: 0
2: 1
3: 16
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906114446 Original CRISPR ATAGATATACTAGCAGAGAC TGG (reversed) Intronic
901762896 1:11482097-11482119 ATGTCTATACTAGCAGAGAAAGG - Intronic
903297912 1:22357220-22357242 ATAAAGATACTACCTGAGACTGG + Intergenic
904071912 1:27806703-27806725 ATAAAGATACTACCTGAGACTGG + Intronic
905352623 1:37358159-37358181 ATAGAGAGACTGGCAGTGACTGG + Intergenic
905967367 1:42110149-42110171 ATATATATATTTGTAGAGACGGG - Intergenic
906114446 1:43347029-43347051 ATAGATATACTAGCAGAGACTGG - Intronic
906909407 1:49931334-49931356 ATAAAGATACTACCTGAGACTGG + Intronic
906914182 1:49990551-49990573 ATAAAGATACTACCTGAGACTGG - Intronic
907306376 1:53515340-53515362 AGAGATATGCAAGCAGAGCCGGG + Intronic
907382552 1:54103251-54103273 ATAAAGATACTACCTGAGACTGG + Intronic
907448580 1:54526925-54526947 ATAAAGATACTACCTGAGACTGG - Intergenic
907619765 1:55965016-55965038 AAAGCTAGACAAGCAGAGACTGG + Intergenic
907721164 1:56973635-56973657 ATATATATTTTAGTAGAGACGGG + Intergenic
907924888 1:58946146-58946168 ATAAAGATACTACCTGAGACTGG + Intergenic
908003910 1:59709129-59709151 ATAAAGATACTACCTGAGACTGG + Intronic
908210417 1:61894675-61894697 ATAAAGATACTACCTGAGACTGG - Intronic
908210733 1:61896939-61896961 ATAAAGATACTACCTGAGACTGG - Intronic
908636574 1:66173333-66173355 AAAGATATTAAAGCAGAGACGGG + Intronic
908942955 1:69458391-69458413 ATAAAGATACTACCTGAGACTGG - Intergenic
908948425 1:69527786-69527808 ATAAAGATACTACCTGAGACTGG - Intergenic
909091148 1:71227336-71227358 ATAAAGATACTACCTGAGACTGG - Intergenic
910487652 1:87733020-87733042 ATAAAGATACTACCCGAGACTGG - Intergenic
910797613 1:91114811-91114833 AAAAAGATACTACCAGAGACAGG + Intergenic
911102983 1:94108468-94108490 AAAAATATACTAGCGGAGGCAGG - Intronic
911667147 1:100565832-100565854 ATAAAGATACTACCTGAGACTGG - Intergenic
911873485 1:103129259-103129281 ATAGATATACTGCCTGAGACTGG - Intergenic
912044089 1:105433211-105433233 ATAGATAAATTAACACAGACAGG + Intergenic
912984891 1:114418036-114418058 ATAAAGATACTACCTGAGACTGG + Intronic
914827659 1:151146911-151146933 ATACATACAGAAGCAGAGACAGG + Intergenic
915164202 1:153939556-153939578 ATACATCTCCAAGCAGAGACAGG + Intronic
915870959 1:159559176-159559198 ATAAAGATACTACCTGAGACTGG + Intergenic
916233563 1:162562862-162562884 ATACGTATACCAGCAGAGATAGG + Intronic
916982745 1:170155834-170155856 ATTGATCTAGTATCAGAGACAGG - Intronic
917078696 1:171234520-171234542 ATAAAGATACTACCTGAGACTGG - Intergenic
917754244 1:178083483-178083505 ATAAAGATACTACCTGAGACTGG - Intergenic
918331641 1:183466750-183466772 ATAAAGATACTACCCGAGACTGG + Intergenic
918361024 1:183758368-183758390 ATATATATTTTAGTAGAGACGGG + Intronic
919044374 1:192431838-192431860 ATAAAAATACTACCTGAGACTGG - Intergenic
919303423 1:195799468-195799490 ATAAAGATACTAACTGAGACCGG - Intergenic
920065751 1:203268275-203268297 ATATATATATTTGAAGAGACAGG - Intronic
921540122 1:216404064-216404086 ATAAAGATACTACCAGAGACTGG - Intronic
921766114 1:218974069-218974091 ATAAAGATACTATCTGAGACTGG - Intergenic
921770992 1:219039653-219039675 ATAAAGATACTACCTGAGACTGG - Intergenic
922081330 1:222300134-222300156 ATAAAGATACTACCTGAGACTGG + Intergenic
922135586 1:222822071-222822093 ATAAAGATACTACCTGAGACTGG - Intergenic
922334860 1:224610604-224610626 ATAAAGATACTACCTGAGACTGG - Intronic
922370826 1:224909267-224909289 ATAAAAATACTACCTGAGACTGG + Intronic
922644064 1:227267582-227267604 ATAAAGATACTACCTGAGACTGG + Intronic
924116406 1:240752150-240752172 ATAAAGATACTACCTGAGACTGG - Intergenic
924433387 1:244016817-244016839 ATAAAGATACTACCTGAGACTGG - Intergenic
924457830 1:244232160-244232182 ATAGACACACTGGCAGCGACGGG - Intergenic
924794560 1:247283995-247284017 ATAAAGATACTACCTGAGACTGG + Intergenic
1063550734 10:7030537-7030559 ATAAAGATACTACCTGAGACTGG + Intergenic
1063713058 10:8499503-8499525 ATAAAGATACTACCTGAGACTGG + Intergenic
1063803799 10:9613983-9614005 ATAGAGATATTAGGAAAGACAGG - Intergenic
1063863103 10:10333941-10333963 ATAAAGATACTACCCGAGACTGG + Intergenic
1065217403 10:23462552-23462574 ATAGATATACTGGTTGAGGCCGG + Intergenic
1065453318 10:25881055-25881077 ATAAAGATACTACCTGAGACAGG - Intergenic
1065566720 10:27018878-27018900 ATAAAACTACTAGAAGAGACAGG + Intronic
1065632145 10:27691118-27691140 ATAAAGATACTACCTGAGACTGG - Intronic
1065759477 10:28968590-28968612 ATAAAGATACTACCTGAGACTGG + Intergenic
1067419887 10:46135894-46135916 ATATATATATTTGGAGAGACAGG - Intergenic
1068707726 10:60095340-60095362 ATATACGTACTAGTAGAGACTGG + Intronic
1068751908 10:60603831-60603853 ACAGATAGACAAGCAGAGATGGG - Intronic
1068883952 10:62079239-62079261 ATAGCTGGACTAGCAGAGGCAGG + Intronic
1069414093 10:68182802-68182824 AAAAATATACTATTAGAGACCGG - Intronic
1070313521 10:75290862-75290884 ACAGATATTCAAGCAGAGGCTGG - Intergenic
1071540712 10:86480942-86480964 AGAGATAAACAACCAGAGACTGG + Intronic
1071951451 10:90707511-90707533 ATAAAGATACTACCTGAGACTGG - Intergenic
1072299918 10:94050161-94050183 ATAAATATACTACTGGAGACTGG + Intronic
1073591608 10:104762860-104762882 ATAAAGATACTACCTGAGACTGG - Intronic
1073817237 10:107221677-107221699 ATAAAGATACTACCTGAGACTGG + Intergenic
1073947567 10:108768427-108768449 ATAAAGATACTACCTGAGACTGG - Intergenic
1074222046 10:111447624-111447646 ATAAAGATACTACCAGAGACTGG + Intergenic
1074320945 10:112401684-112401706 ATAAAAATGCTAGCAGAGGCTGG - Intronic
1074886243 10:117696051-117696073 ATAAAGATACTACCTGAGACTGG - Intergenic
1075515931 10:123108164-123108186 ATAAAGATACTACCTGAGACTGG - Intergenic
1076241338 10:128910348-128910370 ATAAAGATACTACCTGAGACTGG - Intergenic
1077399007 11:2343842-2343864 ATAAAGATACTACCGGAGACTGG - Intergenic
1078554154 11:12305128-12305150 ATAAATATACTACCCAAGACTGG + Intronic
1078733207 11:13995324-13995346 ATAAAGATACTACCTGAGACTGG + Intronic
1079465102 11:20722824-20722846 ATAAAGATACTACCTGAGACTGG + Intronic
1079596879 11:22261185-22261207 ATAAAGATACTACCTGAGACTGG + Intronic
1079844083 11:25442354-25442376 ATAAATATACTGTCAGGGACTGG + Intergenic
1080228006 11:29982958-29982980 ATAAAGATACTACCTGAGACTGG + Intergenic
1081045323 11:38267007-38267029 ATAAAGATACTACCTGAGACTGG - Intergenic
1081334610 11:41849002-41849024 ACAAATATACTACCTGAGACTGG - Intergenic
1081420463 11:42870326-42870348 ATATATATTTTAGAAGAGACAGG + Intergenic
1081435961 11:43027813-43027835 ATAAAGATACTACCTGAGACTGG + Intergenic
1081452383 11:43184045-43184067 ATAGAGATACTACCTGAGACTGG + Intergenic
1081680884 11:45001544-45001566 ATAAAGATACTACCAGAGACTGG - Intergenic
1081838956 11:46181718-46181740 ATAAATATAATGGCAGAGATTGG - Intergenic
1082273931 11:50201150-50201172 ATAAAGATACTAGCCGAGACTGG + Intergenic
1082898962 11:58225442-58225464 ATAAATACACTACCTGAGACGGG + Intergenic
1083182841 11:60998985-60999007 TTATATATATTAGTAGAGACTGG - Intronic
1084300267 11:68245281-68245303 ATAAAGATACTACCAGAGACTGG - Intergenic
1084453856 11:69256142-69256164 ATAAAGATACTACCTGAGACTGG + Intergenic
1084879536 11:72160397-72160419 ATATATGTAATAGTAGAGACAGG + Intergenic
1085459295 11:76683566-76683588 ATAAAGATACTACCTGAGACTGG - Intergenic
1085695881 11:78704185-78704207 ATATATATATTTGTAGAGACAGG + Intronic
1086064210 11:82729916-82729938 ATAAAGATACTACCTGAGACTGG + Intergenic
1086992813 11:93324224-93324246 ATACATATACAAGATGAGACTGG + Intergenic
1087257647 11:95974412-95974434 ATAAAGATACTACCTGAGACTGG - Intergenic
1087336481 11:96850950-96850972 ATAAAGATACTACCTGAGACTGG - Intergenic
1087552050 11:99663835-99663857 ATAAAGATACTACCTGAGACTGG - Intronic
1088145582 11:106672420-106672442 AAACATATACTAGCAGGGAGTGG + Intergenic
1088397131 11:109381527-109381549 ATAAAGATACTACCTGAGACTGG + Intergenic
1088844549 11:113653883-113653905 ATAAAGATACTACCTGAGACTGG + Intergenic
1089230021 11:116965720-116965742 ATATATATTTTAGCAGAGACGGG - Intronic
1089790939 11:120943071-120943093 ATAGAGATATTGGGAGAGACAGG - Intronic
1089991943 11:122869785-122869807 ATAGATGTACTAGCTGGGAAAGG + Intronic
1090436151 11:126688053-126688075 ATTGACATACTAGCAGAGGCAGG - Intronic
1092637891 12:10471008-10471030 ATAAAAATACTACCTGAGACTGG - Intergenic
1092952218 12:13516870-13516892 ATAAAGATACTACCCGAGACTGG - Intergenic
1093371185 12:18367510-18367532 ATAAAGATACTACAAGAGACTGG + Intronic
1094281549 12:28745449-28745471 ATAGATACTCCAGAAGAGACAGG - Intergenic
1095044371 12:37484714-37484736 ATAAAGATACTACCTGAGACTGG + Intergenic
1095731681 12:45512526-45512548 ATAAAGATACTATCCGAGACTGG + Intergenic
1097211122 12:57370686-57370708 ATAAACATACTACCTGAGACTGG - Intronic
1097461970 12:59873122-59873144 ATAAAGATACTACCTGAGACTGG - Intergenic
1098404240 12:70107651-70107673 ATAAAAATACTACCTGAGACTGG + Intergenic
1098593076 12:72237772-72237794 ATAGAGTTACTACCTGAGACTGG - Intronic
1098782595 12:74705528-74705550 ATAAAGATACTACCTGAGACTGG - Intergenic
1098969972 12:76842922-76842944 ATAGTTGAACTTGCAGAGACAGG + Exonic
1099137187 12:78920311-78920333 ATAGATATAATACCTGTGACTGG + Intronic
1099229047 12:80001997-80002019 ATAAAGATACTATCTGAGACTGG + Intergenic
1100072333 12:90735920-90735942 ATAAAGATACTACCTGAGACTGG + Intergenic
1100164411 12:91900323-91900345 ATAAAGATACTATCTGAGACTGG - Intergenic
1100352808 12:93800712-93800734 ATAAAGATACTACCTGAGACTGG - Intronic
1100467310 12:94857771-94857793 ATAAAGATACTACCTGAGACTGG + Intergenic
1100493489 12:95103089-95103111 TCAGCTATACTAGCAGAGCCAGG - Intronic
1101576145 12:105998494-105998516 ATAGATATACTAGAAGGTAGAGG - Intergenic
1102164890 12:110798297-110798319 ATAAAGATACTACCTGAGACTGG + Intergenic
1103031030 12:117613032-117613054 ATAAAGATACTACCAGAGACTGG - Intronic
1103358303 12:120338211-120338233 ATAAAGATACTACCTGAGACTGG + Intergenic
1103717941 12:122956827-122956849 ATATATCTTTTAGCAGAGACGGG + Intronic
1104084715 12:125463789-125463811 ATAAATATACTACTTGAGACTGG + Intronic
1106412137 13:29517933-29517955 GTAGATAGACGAGGAGAGACCGG + Intronic
1106649625 13:31676247-31676269 ATAGATGAAGTAGCAGAGAGTGG + Intergenic
1106936819 13:34731545-34731567 ATATATATTTTAGTAGAGACAGG + Intergenic
1107713599 13:43175090-43175112 ATAAAGATACTACCTGAGACTGG - Intergenic
1107760343 13:43671263-43671285 ATAAAGATACTAACTGAGACTGG - Intronic
1107790666 13:43998936-43998958 AAAAAGATACTACCAGAGACTGG - Intergenic
1108102906 13:46976338-46976360 ATAAAGATACTACCTGAGACTGG - Intergenic
1108450785 13:50560831-50560853 ATATATAAACAAGCAGAAACAGG - Intronic
1109119444 13:58435693-58435715 AGAGATAAACAAGCAGAGAGTGG + Intergenic
1109297622 13:60553511-60553533 CTAGAGATACTACCTGAGACTGG + Intronic
1109409980 13:61950916-61950938 ATAAATATTTTAGTAGAGACAGG + Intergenic
1109491402 13:63105118-63105140 ACAGATACAATAGCAGGGACTGG - Intergenic
1109966248 13:69700520-69700542 AGGTATATACTTGCAGAGACAGG - Intergenic
1111318479 13:86592619-86592641 ATAAAGATACTATCTGAGACTGG + Intergenic
1111322000 13:86643880-86643902 ATAAAGATACTACCTGAGACTGG + Intergenic
1111628952 13:90825687-90825709 ATAAAGATACTACCTGAGACTGG + Intergenic
1111862999 13:93731651-93731673 ATAGATATACATGCAGATATGGG + Intronic
1113087933 13:106586847-106586869 ATAAAAATACTACCATAGACTGG - Intergenic
1113565396 13:111316779-111316801 ATAAAGATACTACCTGAGACTGG + Intronic
1113611833 13:111652095-111652117 ATATATATTTTAGTAGAGACGGG - Intronic
1113645449 13:111991791-111991813 ATAAAGATACTACCTGAGACTGG - Intergenic
1115262621 14:31469474-31469496 ATAAATATACTACGTGAGACTGG - Intergenic
1115451350 14:33551579-33551601 ATGTATATACTACCAGAGAAGGG + Intronic
1115525677 14:34278424-34278446 ATAAATATACTACCTGAGACTGG - Intronic
1116646378 14:47534379-47534401 ATAAAGATACTACCCGAGACTGG + Intronic
1117141896 14:52797640-52797662 ATAAAGATACTACCTGAGACTGG + Intergenic
1117229292 14:53698911-53698933 ATAAAGATACTACCTGAGACAGG - Intergenic
1117271971 14:54153986-54154008 ATAAAGATACTACCTGAGACTGG + Intergenic
1117445646 14:55801495-55801517 ATAAAGATACTACCTGAGACTGG + Intergenic
1118113972 14:62752932-62752954 ATAAAGATACTATCTGAGACTGG - Intronic
1118553811 14:66989985-66990007 ATAAAGATACTACCTGAGACTGG + Intronic
1119961469 14:78862329-78862351 ATAGATTGACTAGTAGAGAGTGG + Intronic
1120253876 14:82093270-82093292 ATAGAGATACTATGTGAGACTGG - Intergenic
1120263637 14:82220917-82220939 ATAAATATACTACCTGAGACTGG + Intergenic
1120316729 14:82903739-82903761 ATAAAGATACTAGCCAAGACTGG - Intergenic
1120597741 14:86462255-86462277 ATAAAGATACTACCTGAGACTGG + Intergenic
1120683561 14:87511019-87511041 ATAAAAATACTACCTGAGACTGG + Intergenic
1120954255 14:90067817-90067839 ACAGATATACCAGCAAACACGGG - Intronic
1122656451 14:103264427-103264449 ATAGATATACATGTATAGACTGG - Intergenic
1122875627 14:104663177-104663199 ATAAAGATACTACAAGAGACTGG - Intergenic
1123124450 14:105936285-105936307 ATAAAGATACTACCTGAGACTGG + Intergenic
1202942928 14_KI270725v1_random:172403-172425 GTAAATATACTACCTGAGACTGG + Intergenic
1124048441 15:26173063-26173085 ATAAAGATACTACCTGAGACTGG + Intergenic
1124406960 15:29401665-29401687 GTGGATATACTAACAGAAACAGG + Intronic
1124495483 15:30184161-30184183 ATAGTTGTACAAGCAGAGAAGGG - Intergenic
1124748090 15:32354485-32354507 ATAGTTGTACAAGCAGAGAAGGG + Intergenic
1126365302 15:47887971-47887993 ATAAAGATACTACCTGAGACTGG + Intergenic
1126378488 15:48020614-48020636 ATAAAGATACTACCCGAGACTGG - Intergenic
1126885221 15:53141870-53141892 ATAAAGATACTACCCGAGACTGG - Intergenic
1127137469 15:55939459-55939481 ATAAAGATACTACCTGAGACTGG - Intronic
1127581515 15:60343161-60343183 ATAAAGATACTACCCGAGACTGG + Intergenic
1129015331 15:72462794-72462816 ATATATATTTTAGTAGAGACGGG + Intergenic
1129058008 15:72835857-72835879 ATAAAGATACTACCTGAGACTGG + Intergenic
1129070294 15:72945379-72945401 ATAAAAATACTACCCGAGACTGG + Intergenic
1129981918 15:79880374-79880396 ATAAATAAACAAGCAGAGGCCGG - Intronic
1130037760 15:80377175-80377197 ATAAAGATACTACCTGAGACTGG + Exonic
1130435672 15:83896771-83896793 GTAAAGATACTACCAGAGACTGG + Intronic
1131328619 15:91473347-91473369 ATAAAGATACTACCCGAGACTGG - Intergenic
1131532354 15:93204756-93204778 ATAAAGATACTACCGGAGACTGG - Intergenic
1132169541 15:99635159-99635181 ATAGAAATAATATCAGATACTGG + Intronic
1132233468 15:100201469-100201491 ATAAAGATACTACCTGAGACTGG - Intronic
1133083441 16:3342544-3342566 ATAGATAGATAAGCAGAGATGGG - Intergenic
1133748377 16:8705115-8705137 ATAAAGATACTACCTGAGACTGG + Intronic
1133921504 16:10157458-10157480 ATAAAAATACTACCAGAGACGGG + Intronic
1133947476 16:10361246-10361268 ATGAATATACTACCTGAGACTGG - Intronic
1135482844 16:22836827-22836849 ATTTATTTACTAGTAGAGACGGG + Intronic
1135543830 16:23352676-23352698 ATAAAGATACTACCTGAGACTGG - Intronic
1135979525 16:27136562-27136584 ATAAAGATACTACCTGAGACTGG + Intergenic
1136653591 16:31695021-31695043 ATAAAGATACTACCTGAGACTGG + Intergenic
1138380040 16:56593770-56593792 ATAAAGATACTATCTGAGACTGG - Intergenic
1138803475 16:60063824-60063846 ATAAATATACCAGAAAAGACTGG + Intergenic
1139126910 16:64089227-64089249 ATAGAGATACTACCTGAGACTGG + Intergenic
1140948230 16:79791227-79791249 TTAAAAATACTTGCAGAGACTGG + Intergenic
1141532093 16:84653579-84653601 ATACATATATCAGTAGAGACGGG - Intronic
1143778556 17:9216744-9216766 ATAGAAATACAAGGTGAGACTGG + Intronic
1144000711 17:11052212-11052234 ATAAAGATACTACCAGAGACTGG + Intergenic
1144711189 17:17402673-17402695 ATAGGTAAACCAACAGAGACAGG + Intergenic
1148117993 17:45188994-45189016 ATAGGTATTTTAGTAGAGACAGG - Intergenic
1148529205 17:48373089-48373111 ATAAAGATACTACCTGAGACTGG + Intronic
1149343011 17:55706022-55706044 ATAAACATACTACCTGAGACTGG - Intergenic
1149551506 17:57543624-57543646 ATAAATATACTAGCTGAATCAGG - Intronic
1150190947 17:63238691-63238713 ATAAAGATACTACCTGAGACTGG + Intronic
1150655654 17:67037634-67037656 ATAAAGATACTACCTGAGACGGG + Intergenic
1150795917 17:68236750-68236772 ATATATATTTTAGTAGAGACGGG + Intergenic
1150966356 17:69973581-69973603 ATAGATAATATTGCAGAGACAGG - Intergenic
1150989125 17:70235246-70235268 ATATATAAACTAGCAGATTCAGG + Intergenic
1151874845 17:76861891-76861913 ATAAAGATACTACCTGAGACTGG + Intergenic
1153165584 18:2258223-2258245 ATAAAGATACTACCCGAGACTGG + Intergenic
1153206310 18:2706818-2706840 ATAAAGATACTACCTGAGACTGG + Intronic
1153338698 18:3951919-3951941 ATAAAGATACTACCCGAGACTGG - Intronic
1153625272 18:7017146-7017168 ATAGAGATACTACCCAAGACTGG - Intronic
1154175247 18:12083355-12083377 ATAGAGATAATAGCAGAAAAAGG + Intergenic
1154950921 18:21209012-21209034 ATAAAGATACTAACCGAGACTGG - Intergenic
1155289143 18:24323395-24323417 ATACAAAAATTAGCAGAGACGGG + Intronic
1155623807 18:27811553-27811575 ATAAAGATACTATCTGAGACTGG - Intergenic
1155898711 18:31361541-31361563 ATAAAGATACTACCTGAGACTGG + Intergenic
1156331276 18:36126151-36126173 AGAGATAGAGTAGCAGAGACAGG + Intronic
1156904298 18:42335892-42335914 ATAAAGATACTATCTGAGACTGG + Intergenic
1157142713 18:45126677-45126699 ATAAAGATACTACCTGAGACTGG - Intergenic
1157313593 18:46570585-46570607 AAAGATGTAGCAGCAGAGACTGG + Intronic
1157644047 18:49248927-49248949 AAAGTTATAGTAGCAAAGACAGG - Intronic
1158184363 18:54754368-54754390 ATAAAGATACTACCTGAGACTGG - Intronic
1158583138 18:58703437-58703459 ATAGAGGTACTATCTGAGACTGG + Intronic
1158658366 18:59361445-59361467 GTATATATCCAAGCAGAGACAGG - Intergenic
1158670508 18:59469724-59469746 ACAGATATACTTGGAGGGACAGG + Intronic
1159496407 18:69213219-69213241 ATAAAGATACTATCTGAGACTGG + Intergenic
1159649651 18:70962765-70962787 TCAGATGAACTAGCAGAGACCGG + Intergenic
1159697132 18:71574588-71574610 ATAAAGATACTACCTGAGACCGG + Intergenic
1159721537 18:71897886-71897908 GTAAATATACTACCTGAGACTGG - Intergenic
1159930615 18:74309685-74309707 ATAAAGATACTACCTGAGACTGG + Intergenic
1160260741 18:77291997-77292019 ATAAAAATACTACCTGAGACTGG + Intergenic
1160546910 18:79664126-79664148 ATAAAGATACTACCTGAGACTGG + Intergenic
1161033189 19:2069330-2069352 TTTTATATATTAGCAGAGACAGG - Intergenic
1161858831 19:6782724-6782746 ATATATATATTAGCAGAGCATGG + Intronic
1162322414 19:9977976-9977998 ATATATATATTTGTAGAGACAGG + Intronic
1164086246 19:21905279-21905301 ATAAATATACTACCTGAGACTGG + Intergenic
1164912018 19:32020592-32020614 ATAAAGATACTACCTGAGACTGG + Intergenic
1164949939 19:32328659-32328681 AAAAATATTCTAGTAGAGACAGG - Intergenic
1165032143 19:33005740-33005762 ATTGATATAATCTCAGAGACAGG + Intronic
1167204835 19:48094040-48094062 ATAAAGATACTACCCGAGACTGG - Intronic
1167633037 19:50637670-50637692 ATGGAGATAGTAGCAGGGACTGG + Exonic
1168363164 19:55760223-55760245 ATAGCCATCCTAGCAGAGAGGGG + Intronic
1168364113 19:55770224-55770246 ATAGCCATCCTAGCAGAGAGGGG + Intronic
925417906 2:3685280-3685302 ATAAAGATACTACCTGAGACTGG + Intronic
926067707 2:9857584-9857606 ATAAAAATACTACCTGAGACAGG + Intronic
926449355 2:12983445-12983467 ATAAAGATACTACCTGAGACTGG - Intergenic
927336262 2:21928144-21928166 ATAAAGATACTACCTGAGACTGG - Intergenic
928001742 2:27529086-27529108 ATGGATATACTACCTGAGACTGG - Intergenic
928849637 2:35729676-35729698 ATAAATATACTACCCAAGACTGG + Intergenic
930168715 2:48229707-48229729 ATAAAGATACTACCTGAGACTGG - Intergenic
930530542 2:52583048-52583070 ATAAAGATACTACCTGAGACAGG + Intergenic
930800917 2:55441894-55441916 ATACATATATTAGAAGAGTCTGG + Intergenic
932017423 2:68045631-68045653 GTTGATTTACTAGCAAAGACGGG - Intronic
932931592 2:76046321-76046343 ATACAGATACTACCTGAGACTGG - Intergenic
933167132 2:79088496-79088518 ATAAAGATAATACCAGAGACTGG + Intergenic
933458210 2:82543936-82543958 ATAAAGATACTACCCGAGACTGG - Intergenic
933935580 2:87200991-87201013 ATATATATTTTAGTAGAGACGGG - Intergenic
935008773 2:99110369-99110391 ATAGATATACTTTCAGATAGAGG + Intronic
935674332 2:105581326-105581348 ATGGAGACACTAGCAAAGACTGG - Intergenic
935805091 2:106737695-106737717 ATAAAGATACTATCTGAGACTGG - Intergenic
935808389 2:106771450-106771472 TTAGATATATTATCAGAAACTGG - Intergenic
936014622 2:108948473-108948495 ATAAAGATACTACCTGAGACTGG + Intronic
936293823 2:111249566-111249588 ATATATATTTTAGTAGAGACTGG + Intergenic
936655507 2:114481730-114481752 ATAAAGATACTACCTGAGACTGG + Intronic
936660839 2:114541997-114542019 ATATATATTCAAGCAGAAACTGG - Intronic
936850908 2:116896552-116896574 ATAAAGATACTACCTGAGACTGG + Intergenic
937527075 2:122784208-122784230 CTAGATATAAAAGCAGAGATAGG - Intergenic
937604619 2:123783381-123783403 ACAGATGTGCTAGCAGTGACAGG - Intergenic
937763813 2:125635870-125635892 GTATATATACTAGCAAACACTGG - Intergenic
938745830 2:134277297-134277319 ATAAAGATACTACCTGAGACTGG + Intronic
939507016 2:143057850-143057872 ATAAAGATACTACCTGAGACTGG + Intergenic
939854654 2:147343807-147343829 ATAAAGATACTATCTGAGACTGG - Intergenic
939895982 2:147791782-147791804 ATAAAGATACTACCTGAGACTGG - Intergenic
940155441 2:150651277-150651299 ATAGATATAAGAGCAAAGCCAGG + Intergenic
940479371 2:154208794-154208816 ATATATATACTTTCAGAGATTGG - Intronic
940598179 2:155820592-155820614 ATATATATACTACCTGAGACTGG - Intergenic
941056043 2:160789951-160789973 ATATATGTACTAGCAGATAAGGG + Intergenic
941203807 2:162546975-162546997 ATAAAGATACTATCTGAGACTGG + Intronic
941429603 2:165398406-165398428 ATAAAGATACTACCTGAGACTGG + Intergenic
942570659 2:177310906-177310928 ATAAAGATACTACCTGAGACTGG + Intronic
942776763 2:179590914-179590936 ATAAAGATACTACCTGAGACTGG - Intronic
943893058 2:193316627-193316649 ATAAATATATTACCTGAGACTGG + Intergenic
944024448 2:195146291-195146313 ATAAAGATACTACCTGAGACTGG - Intergenic
945739346 2:213641759-213641781 ATAAAGATACTACCTGAGACTGG + Intronic
946100234 2:217314280-217314302 ACAGATAGGCTAGAAGAGACAGG + Intronic
946880037 2:224168148-224168170 ATAAAGATACTACCTGAGACTGG - Intergenic
946948902 2:224850921-224850943 ATAAAGATACTACCCGAGACTGG - Intronic
947053193 2:226070439-226070461 ATAAAGATACTACCTGAGACTGG - Intergenic
1170971450 20:21120807-21120829 ATAAAGATACTACCTGAGACTGG + Intergenic
1171538921 20:25928336-25928358 ATAAAGATACTACCTGAGACTGG + Intergenic
1171802114 20:29631920-29631942 ATAAAGATACTACCTGAGACTGG - Intergenic
1171841862 20:30223662-30223684 ATAAAGATACTACCTGAGACTGG + Intergenic
1172829453 20:37820805-37820827 ATAAAGATACTACCTGAGACTGG - Intronic
1173240036 20:41287035-41287057 ATAAAGATACTACCTGAGACTGG - Intronic
1173348278 20:42221356-42221378 ATAAGTATACTACCTGAGACTGG + Intronic
1173384481 20:42575037-42575059 ATAAACATACTACCAGAGACAGG - Intronic
1174009931 20:47441541-47441563 TTGGATATAGTAACAGAGACAGG - Intergenic
1174307616 20:49625533-49625555 ATATATATATTTGTAGAGACAGG + Intergenic
1174741598 20:53019887-53019909 ATAAAGATACTACCTGAGACTGG + Intronic
1174756256 20:53161457-53161479 ATAAAAATACTACCTGAGACTGG + Intronic
1174863159 20:54111507-54111529 ATAAAGATACTACCTGAGACTGG + Intergenic
1174918134 20:54674547-54674569 ATAAAGATACTACCTGAGACTGG - Intergenic
1175146361 20:56899438-56899460 ATAAAGATAGTACCAGAGACTGG + Intergenic
1175301389 20:57945794-57945816 ACAGAGATACAAGCAGAGAGAGG + Intergenic
1176975137 21:15312388-15312410 ATAAAGATACTACCTGAGACTGG - Intergenic
1177052403 21:16253686-16253708 ATAAAGATACTACCTGAGACTGG + Intergenic
1177356545 21:20015319-20015341 ATAAAGATACTACCCGAGACTGG - Intergenic
1177674884 21:24284243-24284265 ATAAAGATACTACCTGAGACTGG - Intergenic
1177688039 21:24465623-24465645 ATAAAGATACTATCTGAGACTGG - Intergenic
1177949540 21:27517307-27517329 ATAAAGATACTACCTGAGACTGG - Intergenic
1178178427 21:30131939-30131961 ATAAAGATACTACCTGAGACTGG + Intergenic
1178219321 21:30638091-30638113 ATGAAGATACTACCAGAGACTGG - Intergenic
1178960321 21:37059144-37059166 ATAAAGATACTACCTGAGACTGG + Intergenic
1179964351 21:44792628-44792650 ATAAAGATACTACCTGAGACTGG - Intronic
1180645467 22:17335005-17335027 ATATATATATTAGTAGAGACAGG - Intergenic
1181913025 22:26255608-26255630 TGAGATTTCCTAGCAGAGACAGG - Intronic
1182129236 22:27838823-27838845 ATAGATATAATAACGGATACTGG - Intergenic
1182202860 22:28591282-28591304 ATATATATATTTGTAGAGACAGG + Intronic
1182231969 22:28845087-28845109 ATATATATATTAGCCGAGAATGG + Intergenic
1182392352 22:30009275-30009297 AAGGAGATACTTGCAGAGACTGG - Intronic
1182506342 22:30785968-30785990 ATAAAGATACTACCTGAGACTGG - Intronic
1182523324 22:30898427-30898449 ATAAAGATACCACCAGAGACTGG + Intronic
1183634895 22:39055522-39055544 ATAGAAAAATTAGCAGAGATTGG - Intronic
1184297528 22:43534404-43534426 ATAAAGATACTACCTGAGACTGG - Intronic
950693185 3:14677294-14677316 ATAGATTTAAAAGCAGAGAGAGG - Intronic
950805506 3:15599675-15599697 ATAGATGTAGTAGCACAGAAGGG - Intronic
951447419 3:22798844-22798866 ATAGAGATCCTAGGAGATACAGG - Intergenic
951452279 3:22852930-22852952 ATAGGTGTTTTAGCAGAGACAGG - Intergenic
952667533 3:35924397-35924419 ATAAAGATACTACCTGAGACTGG - Intergenic
953359361 3:42281241-42281263 ATAAAGATAATACCAGAGACTGG - Intergenic
953818683 3:46184812-46184834 ATAAAGATACTACCTGAGACTGG + Intronic
954205337 3:49054731-49054753 ATATATATATTTGTAGAGACAGG - Intronic
955400849 3:58590492-58590514 ATAAAGATACTACCTGAGACTGG + Intronic
955586120 3:60480007-60480029 ATAAAGATATTACCAGAGACTGG + Intronic
955889788 3:63637577-63637599 ATAAAAATACTACCTGAGACTGG - Intergenic
956036914 3:65103014-65103036 ATAAAGATACTACCTGAGACTGG - Intergenic
956281225 3:67559289-67559311 ATAAATATACTACCTGAGACTGG + Intronic
956906937 3:73776272-73776294 ATAAAGATACTACCTGAGACTGG + Intergenic
957000182 3:74875766-74875788 AGAGATATTCTAGCAAAAACAGG - Intergenic
957032646 3:75259800-75259822 ACAGATATACTTGCAGACACAGG - Intergenic
957256028 3:77838930-77838952 ATAAAAATACTACCTGAGACTGG - Intergenic
957258015 3:77863605-77863627 ATAAAGATACTACCTGAGACTGG - Intergenic
957561439 3:81826779-81826801 ATAAAAATACTAGCTGAGACTGG - Intergenic
958050931 3:88345104-88345126 ATATAAATATTTGCAGAGACTGG - Intergenic
958583809 3:96060732-96060754 ATAAAGATACTACCCGAGACTGG - Intergenic
958875616 3:99613374-99613396 ATAGATATACAAGAAAAGAATGG + Intergenic
959175134 3:102898751-102898773 ATAAAGATACTACCTGAGACTGG - Intergenic
959463678 3:106658406-106658428 ATAAAGATACTACCTGAGACTGG + Intergenic
960201702 3:114844363-114844385 ATATATATATTAGCTGAGAGTGG + Intronic
960202928 3:114859847-114859869 ATATATAGAATAGCAGAGAGGGG - Intronic
962061982 3:131938483-131938505 ATAAAGATACTACCTGAGACTGG + Intronic
962641100 3:137387278-137387300 ATAAAGATACTACCTGAGACTGG - Intergenic
962956016 3:140267592-140267614 ATAGTTATATTCTCAGAGACCGG + Intronic
963006906 3:140734896-140734918 ATAAAGATACTACCTGAGACTGG - Intergenic
963499081 3:146101898-146101920 AAAGATTAACTAGAAGAGACGGG + Intronic
963637314 3:147815400-147815422 ATAAACATACTACCTGAGACTGG + Intergenic
964425277 3:156546383-156546405 ATAAAGATACTACCAGAGACTGG - Intronic
964427684 3:156570200-156570222 ATAAAGATACTACCCGAGACTGG - Intergenic
964459264 3:156904668-156904690 ATATATATATTTGGAGAGACAGG + Intronic
964509163 3:157431303-157431325 ATAAAGATACTACCTGAGACTGG - Intronic
964632739 3:158830503-158830525 ATAAAGATACTACCTGAGACTGG - Intergenic
965001170 3:162955777-162955799 TTAGATAAACCAGCAAAGACAGG - Intergenic
965140805 3:164831913-164831935 ATAAAGATACTACCTGAGACTGG - Intergenic
965152904 3:165005177-165005199 ATAAAGATACTACCTGAGACTGG - Intronic
965301661 3:167012365-167012387 ATAAAGATACTACCTGAGACTGG + Intergenic
965387055 3:168057373-168057395 ATACAGATACTACCTGAGACTGG + Intronic
965884315 3:173424952-173424974 ATAAAGATACTACCTGAGACTGG + Intronic
966333508 3:178841487-178841509 ATAAAGATACTACCTGAGACTGG + Intronic
966500628 3:180634981-180635003 ATAAAGATACTACCTGAGACTGG + Intronic
966643451 3:182216221-182216243 ATAAAGATACTACCTGAGACTGG + Intergenic
967208284 3:187144310-187144332 ATAAAGATACTACCTGAGACTGG + Intronic
967523900 3:190470013-190470035 ATAAATATACTACCTGAGACTGG - Intergenic
967810696 3:193758622-193758644 ATAGCGATACTACCTGAGACTGG + Intergenic
968014593 3:195318217-195318239 ATAAAGATACTACCTGAGACTGG - Intronic
968014880 3:195320202-195320224 ATAAAGATACTACCTGAGACTGG - Intronic
968342721 3:197971179-197971201 ATAAAGATACTACCTGAGACTGG + Intronic
969072022 4:4547179-4547201 ATAAAAATACTACCCGAGACTGG - Intergenic
969149407 4:5155844-5155866 ATAAAGATACTACCTGAGACTGG - Intronic
969275681 4:6134318-6134340 ATAAAGATACTACCTGAGACTGG - Intronic
969484376 4:7463868-7463890 CAAGATACAGTAGCAGAGACTGG + Intronic
970047680 4:11874991-11875013 ATAGAGATACTACCTGAGACTGG + Intergenic
970047683 4:11875031-11875053 ATAGAGATACTACCTGAGACTGG + Intergenic
970155859 4:13141235-13141257 ATACAGATACTACCTGAGACTGG - Intergenic
970303512 4:14706096-14706118 ATAAAGATACTACCAGAGACTGG - Intergenic
970461163 4:16276259-16276281 ATAAAGATACTACCTGAGACTGG - Intergenic
970515979 4:16830475-16830497 ATAAAGATACTACCTGAGACTGG - Intronic
970575617 4:17423956-17423978 ATAAATAAACTACCGGAGACTGG - Intergenic
970611284 4:17727449-17727471 ATAAAGATACTAGCTGAGACTGG + Intronic
970668191 4:18362414-18362436 ATAGATATAAGAGTATAGACTGG - Intergenic
970687567 4:18585841-18585863 ATAAAGATACTACCTGAGACTGG - Intergenic
970758429 4:19453775-19453797 ATAAAGATACTATCTGAGACTGG - Intergenic
971039357 4:22734127-22734149 ATAAAGATACTATCTGAGACTGG - Intergenic
971112936 4:23609322-23609344 ATAAAGATACTACCTGAGACTGG - Intergenic
971459424 4:26878679-26878701 ATAAAGATACTACCTGAGACTGG + Intronic
971889779 4:32505613-32505635 ATAGATTAATTAGCAGATACAGG - Intergenic
972198126 4:36679052-36679074 ATAAAGATACTACCTGAGACTGG + Intergenic
972242684 4:37210305-37210327 ATAAAGATACTACCAGAGACTGG - Intergenic
972340857 4:38151428-38151450 ATAAAGATACTACCTGAGACTGG + Intergenic
972433292 4:39005538-39005560 ATAAAGATACTATCCGAGACTGG - Intronic
972653944 4:41048379-41048401 ATTGATATATTAGCAGTTACGGG - Intronic
972880413 4:43416389-43416411 ATAAACATACTACCTGAGACTGG + Intergenic
972880807 4:43419290-43419312 GTAAATATACTACCTGAGACTGG + Intergenic
973540840 4:51933849-51933871 ATATATATATTAGTAGAGATGGG - Intergenic
973602971 4:52560276-52560298 ATAAAGATACTACCAGAGACTGG + Intergenic
973736111 4:53872949-53872971 ATAAAGATACTACCTGAGACTGG - Intronic
974141436 4:57893526-57893548 ATAAAGATACTACCTGAGACTGG + Intergenic
974177555 4:58344126-58344148 ATAAAGATACTACCTGAGACTGG - Intergenic
974233027 4:59141536-59141558 TTAAATATATTAGCAGAGAGTGG - Intergenic
974252779 4:59409637-59409659 ATAAAGATACTACCTGAGACTGG - Intergenic
974593700 4:63988870-63988892 ATAGAGATATTACCCGAGACTGG - Intergenic
974631750 4:64500323-64500345 ATAAAGAAACTACCAGAGACTGG + Intergenic
974702606 4:65471517-65471539 ATAAAGATACTACCTGAGACTGG + Intronic
974805997 4:66881976-66881998 ATAAAGATACAACCAGAGACTGG - Intergenic
975884262 4:78945507-78945529 ATAAAGATACTACCTGAGACTGG + Intergenic
976069990 4:81230457-81230479 ATAAAGATACTACCTGAGACTGG - Intergenic
976383895 4:84433369-84433391 ATAGAGAAAGAAGCAGAGACAGG + Intergenic
976662721 4:87556468-87556490 ATAGATAGACGATCTGAGACTGG - Intergenic
976678861 4:87733028-87733050 ATAAAGATACTACCTGAGACTGG + Intergenic
976908612 4:90271798-90271820 ATAAAGATACTACCTGAGACTGG + Intronic
977303064 4:95290148-95290170 ATAGAAAAACTAGCAGAGTATGG + Intronic
977712027 4:100137428-100137450 ATATAGATACTACCTGAGACTGG - Intergenic
977772628 4:100878032-100878054 ATAAAGATACTACCTGAGACTGG + Intronic
978688441 4:111478386-111478408 ATAAAGATACTACCTGAGACTGG + Intergenic
978696440 4:111585425-111585447 ATAAAGATACTATCTGAGACTGG + Intergenic
978809630 4:112836348-112836370 ATAAAGATACTACCTGAGACTGG - Intronic
978962262 4:114695674-114695696 ATATATATACTAGCAGAAATTGG + Intergenic
979310119 4:119193194-119193216 ATAAAGATACTACCTGAGACTGG - Exonic
979740005 4:124137713-124137735 ATAAAAATACTACCTGAGACTGG - Intergenic
980271899 4:130594954-130594976 ATAAAGATACTACCTGAGACTGG + Intergenic
980424975 4:132617308-132617330 ATAAAGATACTACCTGAGACTGG + Intergenic
980487025 4:133471434-133471456 ATAAAAATACTACCTGAGACTGG - Intergenic
980493680 4:133562652-133562674 ATAAAAATTATAGCAGAGACAGG + Intergenic
980515480 4:133852320-133852342 ATAAAGATACTACCTGAGACTGG - Intergenic
980601053 4:135025491-135025513 ATAGTTATATTAGATGAGACAGG - Intergenic
980683098 4:136189048-136189070 ATAAAGATACTACCAAAGACTGG + Intergenic
980707722 4:136521026-136521048 ATAAAGATACTACCTGAGACTGG + Intergenic
981176712 4:141691043-141691065 ATAAAGATACTACCTGAGACTGG + Intronic
981486477 4:145291760-145291782 ATAAAGATACTACCTGAGACTGG - Intergenic
981523443 4:145688688-145688710 ATAAAGATACTACCTGAGACTGG - Intronic
981537740 4:145817396-145817418 ATAAAAATACTACCAGAGACTGG + Intronic
981831349 4:149005553-149005575 ATAAAGATACTACCACAGACTGG - Intergenic
982382966 4:154769926-154769948 ATAAAGATACTACCTGAGACTGG + Intergenic
982486259 4:155969005-155969027 ATAAAAATACTACCTGAGACTGG - Intergenic
983072863 4:163290873-163290895 ATAAAGATACTACCTGAGACTGG + Intergenic
983089636 4:163488212-163488234 ATAAAGATACTACCTGAGACTGG + Intergenic
983578875 4:169288024-169288046 ATAAAGATACTACCCGAGACTGG + Intergenic
984355825 4:178655694-178655716 ATACAGATACTACCAGAGACTGG - Intergenic
985256837 4:188078666-188078688 ATCTATATACTAACAGAGAAAGG - Intergenic
985813398 5:2108135-2108157 ATAAATATACTACCTGAGACTGG + Intergenic
986004890 5:3659271-3659293 ATAGATATGAATGCAGAGACAGG - Intergenic
986197450 5:5551158-5551180 ATAAAGATACTACCTGAGACTGG + Intergenic
987166649 5:15204834-15204856 ATAAAGATACTACCTGAGACTGG - Intergenic
987268892 5:16284796-16284818 ATAAAGATACTACCTGAGACTGG + Intergenic
987352598 5:17034457-17034479 ATAAAGATACTACCTGAGACTGG - Intergenic
987363021 5:17123706-17123728 ATAAAGATACTACCTGAGACTGG + Intronic
987545760 5:19308871-19308893 ATAAATATAATATCTGAGACTGG + Intergenic
988076985 5:26365631-26365653 ATAAATATACTACCTGAGACTGG - Intergenic
988166299 5:27594557-27594579 GTAGAAATAGTAGCAAAGACTGG - Intergenic
988221090 5:28348126-28348148 ATAAAGATACTACCTGAGACTGG - Intergenic
988310167 5:29547531-29547553 ATAAAGATACTACCTGAGACTGG + Intergenic
988310429 5:29549523-29549545 GTAAATATACTACCTGAGACTGG + Intergenic
989351766 5:40494822-40494844 ATAAAGATACTACCTGAGACTGG - Intergenic
989479373 5:41912472-41912494 ATAAAGATACTACCTGAGACTGG + Intronic
990015775 5:51060919-51060941 ATAAAGATACTATCTGAGACTGG + Intergenic
990199158 5:53351903-53351925 ATAAAGATACTACCAGAGACTGG + Intergenic
990684453 5:58285743-58285765 ATAAAGATACTACCTGAGACTGG + Intergenic
991116500 5:62961801-62961823 ATAAATATACTACGTGAGACTGG + Intergenic
991163534 5:63533538-63533560 ATAAAGATACTACCCGAGACTGG - Intergenic
991185288 5:63799586-63799608 ATAAAGATACTACCAGAGATTGG - Intergenic
991223099 5:64237993-64238015 ATAAAGATACTACCTGAGACTGG - Intronic
991586443 5:68206839-68206861 ATAAAGATAATACCAGAGACTGG - Intergenic
992631960 5:78690329-78690351 ATAAAGATACTACCTGAGACTGG - Intronic
994047950 5:95330366-95330388 ATAAAGATACTACCTGAGACTGG - Intergenic
994253764 5:97569179-97569201 ATAAAGATACTACCTGAGACTGG + Intergenic
994568635 5:101484870-101484892 ATAAAGATACTACCTGAGACTGG + Intergenic
994813851 5:104557893-104557915 ATAAACATACTACCTGAGACTGG + Intergenic
994848976 5:105028160-105028182 ATAAAGATACTACCTGAGACTGG - Intergenic
994933723 5:106223629-106223651 ATAGAAATACTAACTGAGGCTGG + Intergenic
995043688 5:107619633-107619655 ATATATTTTTTAGCAGAGACGGG + Intronic
995174571 5:109160379-109160401 ATTGATATACTAATAGAGAAAGG - Intronic
995311561 5:110717917-110717939 ATACACATACTACCTGAGACTGG - Intronic
996605067 5:125312470-125312492 ATAAAGATACTACCTGAGACTGG + Intergenic
997810061 5:136958281-136958303 CTAGATATACAAACAGAGAATGG - Intergenic
998576931 5:143327080-143327102 ATAAAGATACTATCTGAGACTGG + Intronic
998810296 5:145959673-145959695 ATATATATATCAGCAGAGGCAGG + Intronic
999433679 5:151545347-151545369 ACAGATATGCTACCAGTGACAGG + Exonic
999792072 5:154950000-154950022 ATAAAGATACTACCTGAGACTGG + Intronic
999903603 5:156114415-156114437 ATAGATCTATTATCAGAGAAGGG - Intronic
1000575178 5:162967698-162967720 ATAAAAATACTAGCTGAGACTGG + Intergenic
1000643531 5:163734603-163734625 ATAAAGATACTACCTGAGACTGG + Intergenic
1001558314 5:172651586-172651608 TTAGACATACTAGCAGAAAGAGG - Intronic
1001710316 5:173773150-173773172 ATATATATATTTGTAGAGACAGG - Intergenic
1002509809 5:179707209-179707231 TTAGATATAATAGCAGATAGAGG + Intronic
1003230141 6:4244369-4244391 ATAAAGATACTACCTGAGACTGG + Intergenic
1003279433 6:4678888-4678910 ATAAAGATACTACCTGAGACTGG - Intergenic
1003362046 6:5436313-5436335 AGAGATCAACTACCAGAGACAGG - Intronic
1003778090 6:9391970-9391992 ATAAAGATACTACCTGAGACTGG + Intergenic
1004422793 6:15486910-15486932 ATAAAGATACTACCTGAGACTGG + Intronic
1004457926 6:15808765-15808787 ATAAAGATACTACCAGAGACTGG - Intergenic
1007009495 6:38401396-38401418 ATAAAGATACTACCTGAGACTGG - Intronic
1007021386 6:38525387-38525409 ATAAAGATACTACCTGAGACCGG - Intronic
1009685814 6:66955590-66955612 ATAAAGATACTACCCGAGACTGG + Intergenic
1009787877 6:68361638-68361660 ATAAAGATACTACCTGAGACTGG - Intergenic
1010344877 6:74799718-74799740 ATAAATATACTACCTGAGACTGG - Intergenic
1010345193 6:74802001-74802023 ATAAAGATACTACCTGAGACTGG - Intergenic
1010366479 6:75058027-75058049 ATAAAGATACTAGCTGAGACTGG + Intergenic
1010396107 6:75393971-75393993 TTAGAGGTACTAGCAGAGGCTGG + Intronic
1010711157 6:79176012-79176034 ATTGATATAATAGAAGAGAGAGG + Intergenic
1010821591 6:80421349-80421371 ATAAAAATACTACCAGAGACTGG - Intergenic
1010821847 6:80423325-80423347 ATAAAAATACTACCTGAGACTGG - Intergenic
1010974420 6:82296381-82296403 ATAAAGATACTACCTGAGACTGG - Intergenic
1011316876 6:86043099-86043121 ATAGAAATACTAACAGTTACAGG + Intergenic
1012153300 6:95783420-95783442 ATAAAGATACTATCTGAGACTGG + Intergenic
1012342237 6:98142071-98142093 ATAAAGATACTACCTGAGACTGG + Intergenic
1012342496 6:98144075-98144097 ATAAAGATACTACCTGAGACTGG + Intergenic
1012576271 6:100803534-100803556 ATAAAAATACTACCTGAGACTGG - Intronic
1012653379 6:101784864-101784886 ATAAAGATACTACCTGAGACTGG - Intronic
1012716837 6:102685211-102685233 ATAAATATACTACCTGAGACTGG + Intergenic
1013241187 6:108247265-108247287 ATAAATTTACTACCCGAGACTGG - Intronic
1014403023 6:121014748-121014770 ATAAAGATACTACCTGAGACTGG + Intergenic
1014544170 6:122713673-122713695 ACAGATATTCTAGCACAGAAAGG - Intronic
1014668856 6:124273486-124273508 ATAAAGATACTACCTGAGACTGG - Intronic
1015219182 6:130784564-130784586 ATAAAGATACTACCTGAGACTGG - Intergenic
1015594719 6:134855593-134855615 ATAAAGATACTACCGGAGACTGG + Intergenic
1016143812 6:140645440-140645462 ATAAAGATACTACCTGAGACTGG + Intergenic
1016234144 6:141841718-141841740 ATAAAGATACTACCCGAGACTGG - Intergenic
1016271302 6:142293518-142293540 ATAAAGATACTACCTGAGACTGG + Intergenic
1016910951 6:149198636-149198658 ATAGAAAAACTAGGAGAGGCCGG + Intergenic
1017047793 6:150363704-150363726 ATAAAGATACTACCTGAGACTGG + Intergenic
1017051181 6:150395180-150395202 CTGTATATTCTAGCAGAGACTGG + Intronic
1017299176 6:152835775-152835797 ATAAAGATACTACCTGAGACTGG + Intergenic
1017362210 6:153587765-153587787 ATAAAGATACTACCCGAGACTGG - Intergenic
1017419084 6:154254254-154254276 ATAAACATACTAACTGAGACTGG + Intronic
1017589077 6:155959214-155959236 ATAAAGATACTACCTGAGACTGG + Intergenic
1017628166 6:156369443-156369465 ATAAAGATACTAGCCAAGACTGG + Intergenic
1017963619 6:159244894-159244916 ATAAAGATACTACCTGAGACTGG + Intronic
1018377320 6:163225511-163225533 ATAAAGATACTACCTGAGACTGG - Intronic
1018520788 6:164648815-164648837 ATATATATAATAGCAGAGCATGG - Intergenic
1018920176 6:168167130-168167152 ATAAAGATACTACCTGAGACTGG + Intergenic
1019129192 6:169860946-169860968 ATAAAGATACTACCTGAGACTGG - Intergenic
1020704700 7:11529745-11529767 ATAAAGATACTATCTGAGACTGG - Intronic
1020988165 7:15162250-15162272 ATAAATATACTACCTGAGACTGG - Intergenic
1021643934 7:22768943-22768965 ATAAATATACTACCTAAGACTGG - Intergenic
1021973813 7:25991494-25991516 ATACAGATACTACCTGAGACTGG - Intergenic
1022455545 7:30555309-30555331 ATAAAGATACTACCTGAGACTGG + Intergenic
1022706105 7:32803424-32803446 ATAAAGATACTACCTGAGACTGG + Intergenic
1023225431 7:37964304-37964326 ATAAAGATACTACCAGAGACTGG + Intronic
1024883277 7:54113821-54113843 ATAGATATCAAAGCAGACACTGG + Intergenic
1025098401 7:56115641-56115663 ATATATATTTTAGTAGAGACGGG + Intronic
1025267287 7:57474040-57474062 ATGAAGATACTACCAGAGACTGG - Intergenic
1025290298 7:57714260-57714282 ATAAAGATACTACCTGAGACTGG + Intergenic
1025743516 7:64222604-64222626 ATAAAGATACTACCAGAGAATGG - Intronic
1027475080 7:78619929-78619951 ATAGAAATATTACCAGAAACAGG + Intronic
1028030377 7:85904590-85904612 ATAAAGATACTATCTGAGACTGG - Intergenic
1028271944 7:88802236-88802258 ATAAAGATACTACCTGAGACTGG - Intronic
1030551340 7:110964199-110964221 ATAAAGATACTACCTGAGACTGG - Intronic
1030553613 7:110995765-110995787 ATACAGAGACTAGCAGAAACTGG - Intronic
1030754527 7:113272060-113272082 ATAAAGATACTACCTGAGACTGG + Intergenic
1030754529 7:113272093-113272115 ATAAAGATACTACCTGAGACTGG + Intergenic
1030876922 7:114825351-114825373 ATAAAAATACTACCTGAGACTGG + Intergenic
1031005277 7:116463580-116463602 ATAAAGATATTAGCTGAGACTGG + Intronic
1031113087 7:117635758-117635780 ATAGCTATAATACAAGAGACTGG - Intronic
1031178488 7:118383611-118383633 ATAAAGATACTACCTGAGACTGG - Intergenic
1031638229 7:124128103-124128125 GGAGAAATACTAGTAGAGACTGG - Intergenic
1031725149 7:125229431-125229453 ATAAAGATACTACCTGAGACTGG + Intergenic
1031763296 7:125741564-125741586 ATAGAAAGACTAGTAGAGATAGG - Intergenic
1031808044 7:126330381-126330403 ATAAAGATACTACCTGAGACTGG - Intergenic
1031875052 7:127130208-127130230 ATAAAAATACTACCTGAGACTGG - Intronic
1031992049 7:128204900-128204922 ATAAAGATACTACCTGAGACTGG - Intergenic
1032407494 7:131667291-131667313 ATAAAGATACTACCTGAGACTGG - Intergenic
1032873877 7:136016651-136016673 ATAAAGATACTACCTGAGACTGG + Intergenic
1032962949 7:137060743-137060765 ATAAAGATACTACCTGAGACTGG - Intergenic
1033485457 7:141784910-141784932 ATATAAATATTAGCAGAAACTGG - Intronic
1033632831 7:143177609-143177631 ATAGATAAAATAGAAGAGACAGG + Intergenic
1033783744 7:144704393-144704415 ATAAAGATACTACCTGAGACTGG - Intronic
1033798384 7:144873803-144873825 ATAAAGATACTACTAGAGACCGG - Intergenic
1033905543 7:146197840-146197862 ATAAAAATACTACCTGAGACTGG + Intronic
1033986390 7:147230900-147230922 ATAAAGATACTACCTGAGACTGG + Intronic
1034398817 7:150847969-150847991 ATATATATATTTGTAGAGACGGG - Intronic
1035069558 7:156132166-156132188 ATAAAGATACTACCTGAGACTGG + Intergenic
1035426353 7:158777670-158777692 ATAAAGATACTACCTGAGACTGG - Intronic
1036580202 8:10066828-10066850 AAAGATATACCAGCTGAGCCAGG - Intronic
1036816094 8:11903885-11903907 GTATATATACTTGTAGAGACAGG + Intergenic
1037472042 8:19220260-19220282 ATAAAGATACTACTAGAGACTGG + Intergenic
1037809218 8:22076561-22076583 ATATATATACAATTAGAGACAGG - Intronic
1038015503 8:23511033-23511055 ATAAAGATACTACCTGAGACTGG - Intergenic
1038128978 8:24707986-24708008 ATAAAGATACTACCTGAGACTGG + Intergenic
1038394123 8:27234251-27234273 ATAGAAACACTGGCAGAGTCGGG + Intergenic
1038791400 8:30671470-30671492 ATAAAGATACTACCTGAGACTGG + Intergenic
1039000391 8:32973321-32973343 ATAAAGATACTACCTGAGACTGG - Intergenic
1039286434 8:36046270-36046292 ATATATATACTTCCACAGACAGG - Intergenic
1039399578 8:37257873-37257895 ATAGACACACTTCCAGAGACTGG - Intergenic
1039578153 8:38642151-38642173 ATAAAGATACTACCTGAGACTGG - Intergenic
1039668645 8:39568202-39568224 ATAAAGATACTACCTGAGACTGG + Intergenic
1039703998 8:39989014-39989036 ATAAACATACTACCTGAGACTGG + Intronic
1040640212 8:49324522-49324544 GTAGAGATACTACCTGAGACTGG - Intergenic
1040890449 8:52311531-52311553 ATAACGATACTACCAGAGACTGG + Intronic
1041186694 8:55308278-55308300 ATAAAGATACTACCAGAGACTGG + Intronic
1041338734 8:56818210-56818232 ATAAAGATACTACCTGAGACTGG - Intergenic
1041656271 8:60353432-60353454 ATAAAGATACTACCTGAGACTGG - Intergenic
1041674598 8:60525428-60525450 ATAAAGATACTACCCGAGACTGG - Intronic
1042404560 8:68389133-68389155 CTACATTTTCTAGCAGAGACAGG - Intronic
1043062975 8:75528826-75528848 ATAAAGATACTACCTGAGACTGG + Intronic
1043975434 8:86579967-86579989 ATAAAGATACTACCTGAGACTGG + Intronic
1043997192 8:86832654-86832676 ATATTTCTACTAGCAAAGACTGG - Intergenic
1044635717 8:94321881-94321903 ATAAAGATACTACCTGAGACTGG - Intergenic
1044964440 8:97561455-97561477 ATATATATTTTAGTAGAGACAGG - Intergenic
1045352014 8:101350551-101350573 AGAAAGATACTACCAGAGACTGG + Intergenic
1045546169 8:103130737-103130759 CTAGATATACAAGCAGAAACTGG + Intergenic
1045738534 8:105324267-105324289 ATAGATATATTAATAGATACAGG - Intronic
1045902471 8:107300525-107300547 ATTGAAATACTAGCAGAGTGTGG - Intronic
1046257781 8:111723075-111723097 ATAAAGATACTACCTGAGACTGG + Intergenic
1046702072 8:117412741-117412763 ATAAAGATACTACCTGAGACTGG + Intergenic
1046955597 8:120059907-120059929 ATAAAGATACTAACCGAGACTGG - Intronic
1047379483 8:124345687-124345709 ATAAAGATACTACCTGAGACTGG + Intronic
1047609125 8:126503790-126503812 ATATATATACTTACAGGGACTGG + Intergenic
1047649180 8:126901083-126901105 ATAAAGATACTACCTGAGACTGG - Intergenic
1048619747 8:136118777-136118799 ATATATATATTAGTAGAGACTGG + Intergenic
1048824256 8:138408555-138408577 ATAAATATACTACCTGAGACTGG + Intronic
1049296266 8:141841342-141841364 ATAAAGATACTACCTGAGACTGG - Intergenic
1050445831 9:5721692-5721714 ATAATTATACTGACAGAGACAGG - Intronic
1050821053 9:9880302-9880324 ATAAAAATACTACCTGAGACTGG - Intronic
1051040715 9:12807080-12807102 ATATATATTTTAGTAGAGACAGG - Intronic
1052084516 9:24248037-24248059 ATAGATACTCGAGCAGAGATAGG + Intergenic
1052196128 9:25716854-25716876 ATTGCTATACTACCTGAGACTGG - Intergenic
1052528891 9:29656531-29656553 AAAGATATCCTAGCAAAAACAGG - Intergenic
1053310567 9:37015878-37015900 ATAGAAATACAATGAGAGACTGG - Intronic
1054843723 9:69770483-69770505 ATATATATACTGAGAGAGACAGG + Intergenic
1055157579 9:73083075-73083097 ATAAAGATACTACCTGAGACTGG + Intergenic
1055665548 9:78549386-78549408 ATAAAGATACTACCCGAGACTGG - Intergenic
1056191716 9:84190932-84190954 ACACATATATTAGCAGACACAGG - Intergenic
1056360856 9:85856062-85856084 ATAAAGATACTACCAGAGACTGG - Intergenic
1056637517 9:88344010-88344032 ATATATACACTACCTGAGACTGG + Intergenic
1057770537 9:97963694-97963716 ATACAGAAACTAGCAGAGACAGG - Intergenic
1057841321 9:98487601-98487623 ATATATATATTTGTAGAGACAGG - Intronic
1058345733 9:103959034-103959056 ATAGATAAACCAGCAGATAATGG - Intergenic
1058820650 9:108726328-108726350 TTAAATATACTAACACAGACAGG + Intergenic
1059348869 9:113650510-113650532 AGAGCTATGCAAGCAGAGACTGG - Intergenic
1059603289 9:115804880-115804902 ATATATATATTAGTAGAGGCAGG - Intergenic
1060852533 9:126889501-126889523 ATAGATCATCTGGCAGAGACAGG - Intergenic
1061456599 9:130702748-130702770 ATAGATAAATTAGCAGAGCATGG - Intronic
1185939548 X:4300226-4300248 ATAAAGATACTACCTGAGACTGG - Intergenic
1186051770 X:5604208-5604230 ATAAAGATACTACCAGAGACTGG + Intergenic
1186053483 X:5624726-5624748 ATAGAGATACTACCTGAGACTGG - Intergenic
1187565834 X:20448737-20448759 ATAAAGATACTACCTGAGACTGG + Intergenic
1187813775 X:23209077-23209099 ATAAATAAAGTAGCAGAGAACGG - Intergenic
1188106631 X:26155326-26155348 ATACAGATACTAACCGAGACTGG + Intergenic
1188469006 X:30516068-30516090 ATAAAGATACTACCTGAGACGGG - Intergenic
1188530766 X:31138465-31138487 ATAGAGATACTACCTGAGACTGG + Intronic
1189377694 X:40478596-40478618 ATAGAGTTAGTAGCAGAGAGGGG + Intergenic
1189411741 X:40778911-40778933 ATAAAGATATTACCAGAGACTGG - Intergenic
1189553210 X:42114486-42114508 ATAAAGATACTACCTGAGACTGG + Intergenic
1189720002 X:43906077-43906099 ATAGCTATACTAGCTCAGATTGG - Intergenic
1189903677 X:45735128-45735150 ATAAAGATACTACCTGAGACTGG - Intergenic
1189958813 X:46305863-46305885 ATAAAGATACTATCTGAGACTGG + Intergenic
1190463602 X:50703805-50703827 ATAAAGATACTACCTGAGACTGG - Intronic
1191985926 X:66981465-66981487 ATAAAAATACTACCTGAGACTGG + Intergenic
1191986156 X:66983432-66983454 ATAAATATATTATCTGAGACTGG + Intergenic
1192122191 X:68466976-68466998 ATAGATAAAAAAGAAGAGACTGG + Intergenic
1192955182 X:76062815-76062837 ATAAAAAAACTACCAGAGACTGG + Intergenic
1193012430 X:76691704-76691726 ATACAGATACTACCTGAGACTGG - Intergenic
1193148184 X:78098988-78099010 ATATATATATTTGTAGAGACAGG + Intronic
1193634352 X:83930100-83930122 ATAAATATACTACCTGAGACTGG + Intergenic
1193855050 X:86590302-86590324 ATAAAGGTACTAGAAGAGACTGG - Intronic
1193929980 X:87541672-87541694 ATAAACATACTATCAGAGACTGG - Intronic
1194256739 X:91644466-91644488 ATAAAGATACTACCTGAGACTGG - Intergenic
1194435230 X:93861040-93861062 ATAAAGATACTACCTGAGACTGG - Intergenic
1195080787 X:101367989-101368011 ACAGAAATATTTGCAGAGACTGG - Intronic
1195207104 X:102611887-102611909 ATAAAGATACTACCTGAGACTGG - Intergenic
1195656327 X:107334629-107334651 ATAAAGATACTATCTGAGACTGG - Intergenic
1195806199 X:108770109-108770131 ATAAAGATACTACCTGAGACTGG + Intergenic
1195822254 X:108957624-108957646 ATAAAGATACTATCTGAGACTGG - Intergenic
1196247935 X:113422628-113422650 ATAAAGATACTACCTGAGACTGG - Intergenic
1196505102 X:116433258-116433280 ATAAAGATACTACCTGAGACTGG + Intergenic
1196909645 X:120472600-120472622 ATACATATATTTTCAGAGACAGG - Intergenic
1196926250 X:120636280-120636302 ATAAAGATACTACCTGAGACTGG + Intergenic
1197569661 X:128132796-128132818 ATAAAGATACTACCTGAGACTGG - Intergenic
1198304496 X:135367485-135367507 ATAAAGATACTACCTGAGACTGG + Intergenic
1198444984 X:136704484-136704506 ATAAAGATACTATCTGAGACTGG + Intronic
1198630287 X:138629669-138629691 ATAAAGATACTACCTGAGACTGG - Intergenic
1199026527 X:142945354-142945376 ATAAAGATACTACCTGAGACTGG - Intergenic
1199061526 X:143361268-143361290 ATAAAGATACTATCTGAGACTGG + Intergenic
1199270856 X:145881432-145881454 ATACAGATACTACCTGAGACTGG + Intergenic
1199306078 X:146268996-146269018 ATAAAGATACTACCTGAGACTGG - Intergenic
1199931663 X:152529905-152529927 ATAAAGATACTACCTGAGACTGG + Intergenic
1200375492 X:155775351-155775373 ATAGAAATACAGGCAGAGAAAGG - Exonic
1200575458 Y:4883728-4883750 ATAAAGATACTACCTGAGACTGG - Intergenic
1200826083 Y:7643046-7643068 ATAGTAATACTGGCAGAGAATGG - Intergenic
1200882506 Y:8232249-8232271 ATAGTAATACTGGCAGAGAATGG - Intergenic
1201621474 Y:15963796-15963818 ATAAAAATACTACCTGAGACTGG + Intergenic
1201990706 Y:20021752-20021774 ATAAAGATACTACCTGAGACTGG - Intergenic
1202106490 Y:21373578-21373600 ATAGTAATACTGGCAGAAACTGG - Intergenic
1202194330 Y:22281813-22281835 ATAGTGATACTGGCAGAGAATGG - Intergenic
1202196392 Y:22302481-22302503 ATAGTAATACTGGCAGAGAATGG + Intergenic
1202201135 Y:22350389-22350411 ATAGTAATACTGGCAGAGAATGG + Intronic