ID: 906116304

View in Genome Browser
Species Human (GRCh38)
Location 1:43359352-43359374
Sequence GCCGGCGCTGTGGGATCGGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 1, 2: 1, 3: 3, 4: 56}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906116304_906116312 0 Left 906116304 1:43359352-43359374 CCAACCGATCCCACAGCGCCGGC 0: 1
1: 1
2: 1
3: 3
4: 56
Right 906116312 1:43359375-43359397 AGGACTCCGGGCCGAACTCCTGG 0: 2
1: 0
2: 0
3: 6
4: 59
906116304_906116317 18 Left 906116304 1:43359352-43359374 CCAACCGATCCCACAGCGCCGGC 0: 1
1: 1
2: 1
3: 3
4: 56
Right 906116317 1:43359393-43359415 CCTGGTCAGTGAGGTGCCAAAGG 0: 1
1: 0
2: 2
3: 12
4: 126
906116304_906116314 9 Left 906116304 1:43359352-43359374 CCAACCGATCCCACAGCGCCGGC 0: 1
1: 1
2: 1
3: 3
4: 56
Right 906116314 1:43359384-43359406 GGCCGAACTCCTGGTCAGTGAGG 0: 1
1: 0
2: 0
3: 5
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906116304 Original CRISPR GCCGGCGCTGTGGGATCGGT TGG (reversed) Exonic
900100900 1:961568-961590 GGCGGCGCTGGGGGCTCCGTGGG + Intronic
900334302 1:2153962-2153984 GCTGGCGCTGCAGAATCGGTGGG - Intronic
902636070 1:17735879-17735901 GCGGGGGCTGTGGGACCCGTGGG - Intergenic
904033882 1:27549059-27549081 GCCGGCGCTGTGGGCGCTGCTGG + Exonic
906102108 1:43270459-43270481 GTCGGAGCTGTGGAATGGGTTGG + Intronic
906116304 1:43359352-43359374 GCCGGCGCTGTGGGATCGGTTGG - Exonic
910288808 1:85580868-85580890 GGCGGCGCGGTGGGCCCGGTGGG - Exonic
914916422 1:151822157-151822179 ACCGGAGCTGTGGTCTCGGTGGG - Intronic
918790040 1:188813404-188813426 GCGGGCGCTGTGGGACTGGCAGG + Intergenic
1063200235 10:3780535-3780557 GCCGGGGCTGTGGGTCCGGCAGG - Intronic
1066616914 10:37304357-37304379 GCAGGCGCTGTGGGATTACTTGG + Intronic
1069801420 10:71084257-71084279 GGCGGGGCTGTGGGATTGGTGGG - Intergenic
1073326080 10:102644519-102644541 GCCGGAGCTCGGGGCTCGGTGGG + Exonic
1077162468 11:1119988-1120010 GCAGGGGCTGTGGGAATGGTAGG + Intergenic
1083621133 11:64049957-64049979 GCTGGCTCTGTGCGATCGCTAGG - Intronic
1089688036 11:120169305-120169327 GCCGGGGCCGTGGGGGCGGTGGG + Intronic
1101510581 12:105389258-105389280 GGCGGTCCTGTGGGATGGGTTGG - Intronic
1103917013 12:124380901-124380923 TCCGGCACTGTGGGATCAGGAGG + Intronic
1104857115 12:131907561-131907583 GCGGGCCCTGTGGGACCGGCTGG - Intronic
1115119850 14:29927110-29927132 GCCGGCGCTCTGGAAGCGGCTGG - Intronic
1117156820 14:52950635-52950657 GCCGGCGCTGCGAATTCGGTGGG - Intronic
1122546875 14:102527949-102527971 GCCTGCCCTGTGGGATGGGGAGG + Intergenic
1124014186 15:25862476-25862498 GGCGGCGCTGTGGCTTCGGTCGG + Intronic
1131831385 15:96356869-96356891 GCAGCCACTGTGGGATCTGTCGG + Intergenic
1131863771 15:96684199-96684221 GCTGACGCTGTGGGATTGCTGGG + Intergenic
1142882869 17:2895017-2895039 GCCGGCGCTGTGCGGACGCTGGG - Intronic
1143565555 17:7718186-7718208 GCCTGCGGTGTGGGATCGCGTGG + Exonic
1145004516 17:19329875-19329897 GCCGGGGCTGTGGAATCTGCAGG - Intronic
1145290090 17:21536231-21536253 GCCAGGGCTGTGGGATGGGGAGG + Intronic
1150239818 17:63622561-63622583 CCGGGCGCTGTGGCATCGGCAGG - Exonic
1157544516 18:48538810-48538832 GCCAGCGCCGTGGGGTCGCTGGG + Intergenic
1160592420 18:79951780-79951802 GCCGGGGCTGTCGGGGCGGTGGG + Intergenic
1163615174 19:18322929-18322951 GCGGGCGCTGTGGGCTTGGTTGG - Intronic
1165153861 19:33776083-33776105 GCCTGTGCTGTGGGGTGGGTGGG + Intergenic
933180225 2:79218164-79218186 GCCTGCTCTGTGGGAGAGGTGGG - Intronic
948843716 2:240672905-240672927 GGCTGCGCTGCGGGAGCGGTGGG + Intergenic
1180952801 22:19728349-19728371 GCCGCTGCTGTGGGATGGGGAGG - Intergenic
1181026611 22:20131126-20131148 GACGGCGCTGTGGGCGGGGTGGG - Intronic
961823829 3:129588570-129588592 GCAGACGCTGTGGGCTGGGTGGG - Intronic
968832344 4:2939476-2939498 GCCAGGGCTGTGGGCTCAGTGGG - Intronic
969477066 4:7427823-7427845 GGCGGTGGTGTGGGATCGTTGGG - Intronic
970449703 4:16154784-16154806 GCCGGCACTCTGGGATCAGAAGG + Intergenic
985776867 5:1848903-1848925 GCCTGCGCTGTGGCATCGGTCGG - Intergenic
988577811 5:32444122-32444144 GCCGGGGCTCTGGGATGGCTGGG + Intronic
990410417 5:55535338-55535360 GCCGGTGCTCTAGGATCGTTGGG - Intergenic
999749271 5:154614686-154614708 CCAGGCGCTGTGTGATCTGTGGG + Intergenic
1019277711 7:184626-184648 GCCAGCGCTGTGGGAGGGGCTGG - Intergenic
1019562688 7:1666223-1666245 GTCGCCGCTGCGGGATCGGAGGG + Intergenic
1019567475 7:1691605-1691627 GCCTGGGCTGTGGGAGCAGTGGG - Intronic
1021106821 7:16646635-16646657 GCCGGGGCTCTGGGCTAGGTAGG + Intronic
1022503504 7:30896839-30896861 GCTGGCCTTGTGGGATGGGTAGG - Intergenic
1024766668 7:52668573-52668595 GCGGGGGCTGTGGGGTCGCTGGG + Intergenic
1042784980 8:72537001-72537023 GCCGGAGCTGTGCGCTCGGCCGG - Intergenic
1052344933 9:27399984-27400006 GCAGGGGCTGTGGGATCGAAAGG - Intronic
1056481557 9:87011791-87011813 GCTGGCGCTGTGGGATCGGTTGG - Intergenic
1061849219 9:133404773-133404795 GCCAGCTCTGGGGGATGGGTGGG - Exonic
1062116820 9:134814045-134814067 GCGGGCGCTGCGGGAGGGGTGGG + Intronic
1185610837 X:1392822-1392844 GCCGGGGCTGGGGGTTCCGTGGG + Intergenic
1186492318 X:9983651-9983673 GCCGGGGCTGTGGGTTCTCTCGG - Intergenic
1192344487 X:70289975-70289997 GCCGGCGCGGTGGGAAGGGGAGG - Exonic
1200107585 X:153723789-153723811 GCGGGCGCCGTGGGGACGGTGGG - Exonic
1201291191 Y:12421582-12421604 GCCGGCGCTGGGGGCCCGGAGGG + Intergenic