ID: 906116938

View in Genome Browser
Species Human (GRCh38)
Location 1:43363472-43363494
Sequence GGCCAAAGGTCAGGGTGGGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 368}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906116938_906116950 7 Left 906116938 1:43363472-43363494 CCCGCCCACCCTGACCTTTGGCC 0: 1
1: 0
2: 0
3: 26
4: 368
Right 906116950 1:43363502-43363524 TACTGCTTCAGTGTGTGGGGTGG 0: 1
1: 0
2: 2
3: 20
4: 235
906116938_906116949 4 Left 906116938 1:43363472-43363494 CCCGCCCACCCTGACCTTTGGCC 0: 1
1: 0
2: 0
3: 26
4: 368
Right 906116949 1:43363499-43363521 AGCTACTGCTTCAGTGTGTGGGG 0: 1
1: 0
2: 1
3: 25
4: 205
906116938_906116948 3 Left 906116938 1:43363472-43363494 CCCGCCCACCCTGACCTTTGGCC 0: 1
1: 0
2: 0
3: 26
4: 368
Right 906116948 1:43363498-43363520 AAGCTACTGCTTCAGTGTGTGGG 0: 1
1: 0
2: 3
3: 11
4: 133
906116938_906116952 21 Left 906116938 1:43363472-43363494 CCCGCCCACCCTGACCTTTGGCC 0: 1
1: 0
2: 0
3: 26
4: 368
Right 906116952 1:43363516-43363538 GTGGGGTGGAGGAGTGAGACTGG 0: 1
1: 0
2: 5
3: 78
4: 749
906116938_906116947 2 Left 906116938 1:43363472-43363494 CCCGCCCACCCTGACCTTTGGCC 0: 1
1: 0
2: 0
3: 26
4: 368
Right 906116947 1:43363497-43363519 GAAGCTACTGCTTCAGTGTGTGG 0: 1
1: 0
2: 5
3: 16
4: 170
906116938_906116953 22 Left 906116938 1:43363472-43363494 CCCGCCCACCCTGACCTTTGGCC 0: 1
1: 0
2: 0
3: 26
4: 368
Right 906116953 1:43363517-43363539 TGGGGTGGAGGAGTGAGACTGGG 0: 1
1: 1
2: 8
3: 44
4: 567
906116938_906116951 10 Left 906116938 1:43363472-43363494 CCCGCCCACCCTGACCTTTGGCC 0: 1
1: 0
2: 0
3: 26
4: 368
Right 906116951 1:43363505-43363527 TGCTTCAGTGTGTGGGGTGGAGG 0: 1
1: 0
2: 5
3: 69
4: 722

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906116938 Original CRISPR GGCCAAAGGTCAGGGTGGGC GGG (reversed) Exonic
900167028 1:1247915-1247937 GGGCAAAGGGAGGGGTGGGCAGG + Intergenic
900404411 1:2486181-2486203 GGGCAAAGGTCAGGGAGGGAAGG - Intronic
901204280 1:7484997-7485019 GGCCCATGGTGAGCGTGGGCCGG - Intronic
902552797 1:17229288-17229310 AGCCACAGGACAGGATGGGCAGG - Intronic
903134002 1:21297340-21297362 GGCAAGTGGACAGGGTGGGCAGG - Intronic
903219131 1:21859341-21859363 GGCAAAAGAAAAGGGTGGGCCGG - Intronic
903502346 1:23808088-23808110 TCCCAAAGGTCACGGTGGGCAGG - Intronic
903995817 1:27304969-27304991 GGGCAAAGGGCAGGGAGGTCAGG - Intronic
904225210 1:29011400-29011422 GACTAAAGGTCAGGGTTGGAGGG + Intronic
904747434 1:32719871-32719893 GGCCATGGGTCAGGGGGGTCAGG - Intergenic
904890968 1:33779199-33779221 GGCCAAAGAGCAGGCTGGGGTGG - Intronic
904999217 1:34655176-34655198 GGCCCAAGCTCAAGGTGGGAGGG + Intergenic
905196232 1:36279991-36280013 TGCCAACGGTGAGGCTGGGCGGG + Intronic
906116938 1:43363472-43363494 GGCCAAAGGTCAGGGTGGGCGGG - Exonic
907045121 1:51295988-51296010 GCCCACAGCTCAGGGTGGCCTGG + Intronic
907047656 1:51309461-51309483 GGCCAAAGAGCAGGGAGGCCTGG - Intronic
907407104 1:54260392-54260414 GCCCAGTGGTCAGGGAGGGCAGG + Intronic
908250736 1:62263679-62263701 GGGGAAAGGTCATTGTGGGCTGG - Intronic
912511937 1:110195535-110195557 GGCAAAGGTGCAGGGTGGGCAGG - Intronic
912688342 1:111784826-111784848 GGGAAAGGGTCAGGGTGGGAGGG + Intronic
913701171 1:121375896-121375918 GGCCAGATGTCAGGGGGAGCTGG - Intronic
914041726 1:144056363-144056385 GGCCAGATGTCAGGGGGAGCTGG - Intergenic
914136365 1:144904123-144904145 GGCCAGATGTCAGGGGGAGCTGG + Intronic
915285856 1:154851615-154851637 GACAAAAGGTCATGGTGTGCAGG - Intronic
915313871 1:155017467-155017489 GGCCAGAGGGCAGGGCGGGCCGG + Exonic
915442315 1:155952694-155952716 GGCCCCTGGGCAGGGTGGGCAGG + Exonic
915631393 1:157155909-157155931 GGCCCGGGGGCAGGGTGGGCGGG - Intergenic
917197000 1:172477344-172477366 GGCCCAAGTTCAAGGTGGGGAGG + Intergenic
917269449 1:173257479-173257501 GGTCAGAAGTGAGGGTGGGCTGG - Intergenic
917738178 1:177939080-177939102 GAGCAAAGGGAAGGGTGGGCAGG - Intronic
920255223 1:204650072-204650094 GGCCCAGGGCCAGGCTGGGCAGG - Intronic
920276040 1:204805129-204805151 GGCCAAGAGTCAGGCTGGGAGGG - Intergenic
920488594 1:206394618-206394640 GGCCAGATGTCAGGGGGAGCTGG - Intronic
921322887 1:213960369-213960391 AGCCAGAGATCAGGGTGGGTGGG + Intergenic
923525011 1:234765828-234765850 GGTGAGAGGTCAAGGTGGGCTGG - Intergenic
924189178 1:241531356-241531378 GGCCAAGGGTCAAGGTTAGCAGG + Intergenic
1063216793 10:3932464-3932486 GGCGTAAGGTCAGGATGGGCAGG + Intergenic
1064461780 10:15541582-15541604 GGCCAAATGTTAGGCTTGGCTGG - Intronic
1067155743 10:43779904-43779926 TGGCAAAGGTCTTGGTGGGCTGG + Intergenic
1067347081 10:45444462-45444484 GGACAGAGCTCAGGGTGTGCAGG + Intronic
1068055322 10:52005727-52005749 ATCCAGATGTCAGGGTGGGCAGG + Intronic
1068224248 10:54086198-54086220 GGCCAAAGGTGAAGGGGTGCTGG + Intronic
1069804161 10:71107419-71107441 GGCAAAAGTTCACGGTGGGGTGG + Intergenic
1069905584 10:71730427-71730449 GGTGCAAGGTCAGGGTGGGGTGG - Intronic
1070545082 10:77445942-77445964 GGCCAAAAGGCAGTGTGGGCTGG + Intronic
1070718947 10:78743289-78743311 GGCCAAGGGGCAGGATGTGCTGG - Intergenic
1070786724 10:79166361-79166383 CGCCAAAGAGCAGGGTGGGAGGG - Intronic
1071023291 10:81083365-81083387 GGCCCAAGGACAGGAAGGGCCGG + Intergenic
1071529205 10:86376589-86376611 TGCTAAGGGTCATGGTGGGCAGG + Intergenic
1071786466 10:88905850-88905872 GGCTTAGGGTCAGGGAGGGCAGG + Intronic
1072847020 10:98842862-98842884 TGCCAAGGGTTAGGGTGGGAGGG - Intronic
1073371014 10:102989201-102989223 GGCAAAATGTCAGGATGAGCAGG + Intronic
1073486783 10:103824177-103824199 GCCCCAAGGGGAGGGTGGGCAGG + Intronic
1073968792 10:109022561-109022583 GCCTAAAGGTCAGTGTGGTCAGG + Intergenic
1074160120 10:110829996-110830018 AGCCAAAGGGCAGGGTGTGAGGG - Intronic
1074189738 10:111125246-111125268 GGGCAAAGGTCAGTGTGGCAGGG - Intergenic
1074254287 10:111784813-111784835 GACACAAGGTCAGGATGGGCTGG + Intergenic
1074377750 10:112952616-112952638 GGCCAGAGACCAGGGTGTGCGGG + Intronic
1075074822 10:119343668-119343690 GGCAGAAGGTCAGGGGAGGCTGG + Intronic
1076545164 10:131240322-131240344 GGGGAAGGGTCAGGGTGGGAGGG - Intronic
1076560756 10:131361800-131361822 GGACAGAGATCAGGGAGGGCAGG - Intergenic
1077043039 11:532959-532981 CCTCAAAGGTCAGGGTGGCCCGG + Intronic
1077104088 11:834465-834487 GCCCAAGGGCCAGAGTGGGCCGG - Intronic
1077222404 11:1423612-1423634 GTCCAAGGTCCAGGGTGGGCTGG + Intronic
1077375316 11:2202883-2202905 GGCCACAGGGCTGGGTGGGTGGG - Intergenic
1077414307 11:2417712-2417734 GGTGAAAGGTGAGGGCGGGCAGG - Exonic
1077546905 11:3175890-3175912 GGCCAGAGGCCAGTGTGGCCAGG + Intergenic
1077553624 11:3215410-3215432 GTGCCAAGGTCAGGGCGGGCGGG + Intergenic
1077722746 11:4644330-4644352 GGACAGAGGACAGGCTGGGCTGG + Intronic
1077955990 11:7020450-7020472 GGCCAAAGGTCGGGAGGCGCGGG - Exonic
1078937866 11:15967895-15967917 GGGCAGAGGTAAGGGTGGGCGGG - Exonic
1081744666 11:45464463-45464485 GACAAAAGGTCTGGCTGGGCTGG + Intergenic
1082709975 11:56542765-56542787 GGCGGAAGGTCAGGATGGCCTGG + Exonic
1083229653 11:61308230-61308252 GGTCATAGGTGAGAGTGGGCGGG - Intronic
1083327183 11:61878731-61878753 AGCTAAAGGTGAGGGTGGGGTGG - Exonic
1083329512 11:61891048-61891070 GGTCAAAGGTCAGCGAGGGGAGG + Intronic
1083475153 11:62910527-62910549 TGCCAAAGGTGATGATGGGCTGG + Exonic
1083791584 11:64989476-64989498 GGCCAAGGGACAGTGAGGGCAGG + Exonic
1084085416 11:66852851-66852873 GGCAGTGGGTCAGGGTGGGCTGG + Intronic
1084524230 11:69685983-69686005 GGCCGAGGGTCAGGGAGTGCAGG - Intergenic
1084704323 11:70806987-70807009 GGTCAAAGGTCAGTGTCTGCTGG - Intronic
1088129758 11:106473221-106473243 GGGCAAAGGAAAGGGTGGGGAGG - Intergenic
1088469124 11:110175558-110175580 GTCCAGAGGTCTGGGTGGGTGGG + Intronic
1089157839 11:116415601-116415623 GGGCATAGGTCAGGGTTGGGTGG + Intergenic
1089184386 11:116605119-116605141 TGCTAGAGGTCAGGGTGGGATGG - Intergenic
1089316254 11:117593287-117593309 TGCAAGAGGTCAGGGTGGGCGGG - Intronic
1089683697 11:120133622-120133644 GGCTAAAGGCCAGGGTGCCCTGG - Intronic
1090390404 11:126383972-126383994 CGGCAAAGATGAGGGTGGGCAGG - Intronic
1090668479 11:128930554-128930576 GACCAAGGGTCAGGGAGGCCAGG + Intergenic
1090739885 11:129649534-129649556 TGCCAAGGGTTAGGGTGGGAGGG + Intergenic
1090801990 11:130178809-130178831 GGTCAAAGGGAAAGGTGGGCGGG + Intronic
1091771198 12:3152328-3152350 GGCCTGATGCCAGGGTGGGCTGG + Intronic
1092055626 12:5506042-5506064 GCCCAAAGGGAAGGGTGGGAAGG - Intronic
1092165840 12:6341743-6341765 GGACAAAGGGAAGAGTGGGCTGG - Intronic
1092264416 12:6970157-6970179 GGTGAAAGGTCAGGGTCAGCAGG + Intronic
1092874613 12:12837327-12837349 GGTCAGGGGTCAGGGTGGGGAGG + Intergenic
1093513568 12:19957964-19957986 GGTTAAAGGTAAGGGAGGGCAGG - Intergenic
1095951401 12:47783801-47783823 GTCCCAAGGGCATGGTGGGCGGG + Exonic
1095954021 12:47796326-47796348 AGTCAGAGGCCAGGGTGGGCAGG + Intronic
1096255421 12:50059217-50059239 GGTTAAAGGGCAGGGTTGGCTGG - Intronic
1097711230 12:62919829-62919851 GGCAAAAGGGCAGCGTGGCCAGG + Intronic
1098708298 12:73719788-73719810 GGCCTAACATCAGGGTTGGCAGG - Intergenic
1101655670 12:106717877-106717899 GACCAAAGGTCAGCTTGAGCAGG + Intronic
1101968156 12:109294770-109294792 GGACAGAGGTCAGTGTGGGCAGG - Intronic
1102151114 12:110689429-110689451 AGCCTAAGGGAAGGGTGGGCGGG + Intronic
1103921337 12:124400814-124400836 GGCCTGAGGTGAGGGTGGCCAGG + Intronic
1104963996 12:132500962-132500984 GGCCACAGGACAGGGTGTGAGGG - Intronic
1108724141 13:53162494-53162516 GGCCATAGGTAACAGTGGGCAGG - Intergenic
1112007845 13:95269214-95269236 GACTAGAAGTCAGGGTGGGCTGG + Intronic
1113372816 13:109738296-109738318 GAGCAAAGGTCAAGGTGTGCTGG - Intergenic
1113512474 13:110867188-110867210 AGTCTCAGGTCAGGGTGGGCTGG - Intergenic
1114327322 14:21602316-21602338 GGCGGAAGGTCAGGGTGGCCTGG + Intergenic
1114330718 14:21634332-21634354 GGCGGAAGGTCAAGGTGGCCTGG + Exonic
1114988629 14:28261764-28261786 GGCCAAAGGGCAAGGTTGCCTGG - Intergenic
1117374466 14:55108106-55108128 GGACAGTGGTCAGCGTGGGCGGG + Intergenic
1118345788 14:64939754-64939776 GGACAAGGGTGAAGGTGGGCTGG + Exonic
1118607406 14:67514415-67514437 GACCAGAGATCAGGGAGGGCAGG + Intronic
1121096184 14:91219670-91219692 GGCCAAGGGCCAGAGTGGGCAGG - Intronic
1121278556 14:92684623-92684645 GGCCAGGAGACAGGGTGGGCAGG - Intronic
1123685207 15:22792244-22792266 GGCCCAAAGTCAGGCTGCGCAGG + Intronic
1123795086 15:23763144-23763166 AGCCAAAGGGGAGGGTGGGGGGG + Intergenic
1124828666 15:33126334-33126356 GGCAGAAGGTCACTGTGGGCAGG + Intronic
1125886111 15:43230832-43230854 GGCCAGAGGTCAGAATGGGAGGG - Intergenic
1128342930 15:66835215-66835237 CGATAAAGATCAGGGTGGGCAGG + Intergenic
1128816181 15:70610273-70610295 GGAAGAAGGTCAGGGTGGGAGGG - Intergenic
1129161629 15:73751243-73751265 CGCCCAGGGCCAGGGTGGGCTGG - Exonic
1130370622 15:83283495-83283517 GTCCCAAGGCCAGGCTGGGCGGG + Intronic
1130507188 15:84556195-84556217 TGCCAGAGGTCAGAGTGTGCAGG - Intergenic
1132113405 15:99118568-99118590 GGCCAAAGATCTGGGTTGGGAGG - Intronic
1132117245 15:99146409-99146431 GACCAATGGTCAGGGATGGCTGG - Intronic
1132662775 16:1069005-1069027 TGCCAAAGCTGAGGCTGGGCCGG + Intergenic
1132836209 16:1954599-1954621 GGACCAGGGTGAGGGTGGGCTGG - Intronic
1132949164 16:2550939-2550961 GGCCAAGGACCAGCGTGGGCAGG + Intronic
1132965424 16:2651189-2651211 GGCCAAGGACCAGCGTGGGCAGG - Intergenic
1133033150 16:3021140-3021162 GGTCTGAGGTCAGGGTCGGCCGG - Intronic
1133165942 16:3947238-3947260 GGCCACAGGTTGGGCTGGGCTGG + Intergenic
1133284125 16:4682796-4682818 GGACAGAGGAGAGGGTGGGCAGG - Intronic
1133301118 16:4783590-4783612 GGGCAGAGGGCAGAGTGGGCAGG - Intronic
1134067478 16:11238360-11238382 GGTCAGAGGTCAGGTTTGGCTGG - Intergenic
1134102156 16:11460092-11460114 GGCCCAGGGACTGGGTGGGCAGG - Intronic
1136059706 16:27718181-27718203 GGCCAAAGCTCAGCGAGGGGTGG - Intronic
1136229945 16:28880124-28880146 GGGCTAAGGCCAGGCTGGGCGGG - Intronic
1136573900 16:31112106-31112128 AGCCAAAGCTGGGGGTGGGCAGG - Exonic
1136778638 16:32884356-32884378 GGCAAAAGGGCAGGGAGAGCTGG + Intergenic
1136891982 16:33977158-33977180 GGCAAAAGGGCAGGGAGAGCTGG - Intergenic
1137756570 16:50906828-50906850 GGGGGAAGGTCAGGGTGGGCTGG - Intergenic
1139274176 16:65711954-65711976 GGCCAAGGGTCAGGGATTGCTGG + Intergenic
1139580251 16:67868951-67868973 GCCCTAAGGTCAAGGTGGACAGG + Intronic
1139596193 16:67959725-67959747 TGGGAAAGGGCAGGGTGGGCCGG + Intronic
1139597427 16:67966591-67966613 GCCCACAGGCCAAGGTGGGCTGG + Intronic
1139923458 16:70473398-70473420 GCCCAGAGGACAGGGAGGGCAGG - Intronic
1140477402 16:75245724-75245746 GTCCAGAGCTCAGGCTGGGCGGG - Intronic
1141706322 16:85667165-85667187 TGCCAAAGGGCAGGGAGGGAGGG - Intronic
1142012234 16:87721459-87721481 GGCCACAGGTCTGCGTGTGCTGG + Intronic
1203081054 16_KI270728v1_random:1146450-1146472 GGCAAAAGGGCAGGGAGAGCTGG + Intergenic
1144080153 17:11757094-11757116 TGCCAAAGGTGAGGGTTGGGGGG + Intronic
1144673554 17:17146627-17146649 GGCACAGGGTCAAGGTGGGCTGG - Intronic
1144995589 17:19265907-19265929 GACCAAATGTCAGTGTGGGTGGG - Intronic
1145037709 17:19552855-19552877 GGCCCAGGGTCAGCGTGCGCAGG + Intronic
1145243552 17:21253125-21253147 GACAAAAGGTCGGGGCGGGCCGG + Intronic
1145264465 17:21373044-21373066 GGCCAAGGTCTAGGGTGGGCAGG + Intergenic
1145959690 17:28880130-28880152 GGCCAGAGCTCAGCATGGGCAGG - Exonic
1145975404 17:28981265-28981287 TGCCAAAGGGCAGGGCAGGCTGG + Intronic
1146257930 17:31402334-31402356 GGTGAAAGGACAGGGAGGGCAGG + Intronic
1146379981 17:32321238-32321260 GGCCCAAGGTCGGGGAGGGGAGG + Exonic
1146491400 17:33285592-33285614 GGGCAAAGCTGAGGTTGGGCTGG + Intronic
1146806441 17:35868640-35868662 GACCAAAGGTGAGGCTGGGATGG - Exonic
1147256253 17:39184163-39184185 AGTCAGGGGTCAGGGTGGGCTGG + Intronic
1147387579 17:40091195-40091217 GGCTGAGGGTCAGGGTGGGGTGG - Intronic
1147452184 17:40512528-40512550 GTCCAAAGGCCAGAGTGGCCAGG - Intergenic
1147770734 17:42866415-42866437 GGGCAGAGGTCAGGTGGGGCTGG - Intergenic
1148191087 17:45679089-45679111 GGCCAGGGGCAAGGGTGGGCGGG - Intergenic
1148737129 17:49871191-49871213 GGCCACAGGGCAGGGAAGGCAGG - Intergenic
1149495029 17:57112110-57112132 GGCCAAAGATCAGAGTAGGGAGG - Intronic
1150134482 17:62688517-62688539 GGTCAAAGGTCACATTGGGCAGG - Exonic
1150389021 17:64780365-64780387 AGCCCAAGGGCCGGGTGGGCGGG + Intergenic
1150453286 17:65287287-65287309 GGGCAGAGGGCAGGATGGGCTGG + Intergenic
1151309611 17:73285355-73285377 GGTCAAAGGTCATAGTGGGGTGG + Exonic
1151668456 17:75558659-75558681 GGGCAAGGGTCAGGCTGGGCTGG - Intronic
1152438139 17:80288523-80288545 AGCCGAGGGACAGGGTGGGCTGG - Intronic
1153036736 18:770653-770675 GGCAAAAAGCCAGGGTGGGTGGG + Intronic
1153812824 18:8766759-8766781 GGACAGAGCTGAGGGTGGGCAGG + Intronic
1154094030 18:11393592-11393614 GGCCAGAACTCAGGGAGGGCAGG + Intergenic
1158604508 18:58883474-58883496 GGGCCAGGGTCAGGGTCGGCTGG + Intronic
1159836743 18:73345967-73345989 GTCCAAAGGCCAGGGAAGGCTGG + Intergenic
1159903803 18:74072378-74072400 GGCCCAAGGTCATGGAGGACAGG + Intergenic
1160217647 18:76947041-76947063 GGGCAGCGGTGAGGGTGGGCCGG - Intronic
1160828889 19:1093615-1093637 GGGCAAAGGACATGGGGGGCTGG + Intronic
1160837029 19:1129639-1129661 GGCCACAGGTCAGCGTGACCAGG - Intronic
1160846207 19:1167332-1167354 GGTCAGAGGTCCAGGTGGGCTGG + Intronic
1160905863 19:1451529-1451551 TGCCCAAGGGCAGGGTGGGAGGG - Exonic
1161428284 19:4216449-4216471 TCCCTGAGGTCAGGGTGGGCAGG + Intronic
1161885301 19:6990061-6990083 GCCCAGAGGACAGGGTGGGAAGG + Intergenic
1161934065 19:7360530-7360552 GGTGAAAGGCCAGGGTTGGCCGG - Intronic
1162135993 19:8555628-8555650 GGCCAAGGCTGGGGGTGGGCAGG - Intronic
1162321402 19:9973040-9973062 GGTCAGAGGTCAGAGTGGCCTGG + Intronic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
1163634091 19:18430431-18430453 GGACGAAGGGCAGGGTGGGGTGG + Intronic
1163719393 19:18891508-18891530 GGCCTGAGCTCCGGGTGGGCTGG - Intronic
1166043138 19:40215058-40215080 GGGCAAAGGTCAGGGTGGTGGGG - Exonic
1166194215 19:41195500-41195522 GGAGAAAGGTCAGGGTGGGATGG + Intronic
1166326124 19:42052257-42052279 GTGCAAAGGTCAGGGAGGGGAGG - Intronic
1166379788 19:42349936-42349958 GGGCAGAGGTCAGGGTCAGCAGG - Intronic
1166876934 19:45903001-45903023 GGTTAGAGGGCAGGGTGGGCTGG - Intergenic
1167298764 19:48667297-48667319 GGAGAAAGGTCAGGGTGGCCAGG - Intronic
1167706313 19:51083117-51083139 GACCCCAGGGCAGGGTGGGCAGG + Intronic
1167726279 19:51215304-51215326 GGCCAAATGCCAGGGTGGAGAGG + Intergenic
1168353655 19:55689685-55689707 GGTCAAAGGTCAGGCGGGACAGG - Intronic
1168539782 19:57200491-57200513 ACCCAAAGGTCGGGGTGGGGTGG - Intronic
1168588913 19:57616659-57616681 TGCCAAAGGGCAGGGTAGGCAGG + Intronic
1168601457 19:57722129-57722151 GGCCAGAGGTGAGGGTGGCAAGG + Intronic
925413986 2:3656782-3656804 GGGCAGAGGTCAGGGTGTGGAGG + Intergenic
925414000 2:3656824-3656846 GGGCAGAGGTCAGGGTGTGGAGG + Intergenic
926112470 2:10192065-10192087 GCTCAGAGGCCAGGGTGGGCGGG + Intronic
926715590 2:15921423-15921445 GGCCAATGGTGTGGGTGGGGTGG + Intergenic
927435230 2:23060773-23060795 TGAAAAAGGTAAGGGTGGGCCGG + Intergenic
927462968 2:23315151-23315173 GGCCAAAGGTAAGGGTGAAGTGG + Intergenic
927636919 2:24823178-24823200 GGCCAGAGTGCAGGGTGGGATGG + Intronic
927666828 2:25038727-25038749 GACCAAATGTCGGGGTGGGGGGG + Intergenic
928949757 2:36804303-36804325 GGGCACAGGTCTGGTTGGGCAGG - Intronic
929053298 2:37855917-37855939 AGCCAGAAGTCAGGGTGGGATGG + Intergenic
929074739 2:38071210-38071232 GGACATAGGGCAGGTTGGGCTGG + Exonic
929298004 2:40270491-40270513 GGCCAAAGGCCAGGGAATGCAGG - Intronic
929439650 2:41955189-41955211 GCCCAAAGGTGAAGGAGGGCTGG - Intergenic
929599133 2:43194182-43194204 GGCCCAAGGTCACCGTGGGAGGG + Intergenic
932494741 2:72140727-72140749 GGCCAAAGGTCAGGGATGGTGGG + Intronic
934151777 2:89154188-89154210 CCCCAGAGCTCAGGGTGGGCAGG + Intergenic
934215483 2:90027718-90027740 CCCCAGAGCTCAGGGTGGGCAGG - Intergenic
934576156 2:95402802-95402824 GGCCGAAGGTCAAGGGCGGCGGG - Exonic
935090414 2:99890541-99890563 GCTCAGAGGTCAGAGTGGGCAGG + Intronic
937069600 2:119053170-119053192 CGCCAGAAGCCAGGGTGGGCTGG + Intergenic
937244742 2:120485327-120485349 AGCCAAAGGTCAGGCAGGGCAGG + Intergenic
937960453 2:127454054-127454076 GGCCAAAGGTCTTGGTCAGCTGG + Intronic
938065471 2:128279914-128279936 GGCCAGCAGTCAGGGTAGGCTGG - Intronic
939267064 2:139887879-139887901 GGTGACAGGTCAGGGTGGGAAGG + Intergenic
946619138 2:221542107-221542129 GACCAGAGGCCAGGGTAGGCAGG + Intronic
947643095 2:231718081-231718103 GGCCAGAGATCACTGTGGGCTGG - Intergenic
947668810 2:231924147-231924169 GGCCATGGGCCAGGGTGTGCTGG + Intronic
948264298 2:236626058-236626080 GGCCACAGGCCAGTGTGGGGAGG + Intergenic
948266762 2:236640774-236640796 GTCCAGAGGTCAGGGTGATCTGG + Intergenic
948742109 2:240054959-240054981 AACAGAAGGTCAGGGTGGGCTGG + Intergenic
948800549 2:240431492-240431514 GGCCAAGAGTCAGGGTGGGGAGG + Intergenic
948806463 2:240455421-240455443 GGCCAGAGGGAGGGGTGGGCCGG + Intronic
1172497495 20:35398744-35398766 GGCCAAAGGTGGGGGGGGGGGGG + Intronic
1172764267 20:37342835-37342857 GGCTACAGGACAGGGTGGGTGGG - Intergenic
1172790372 20:37500728-37500750 GGCCTGAGGTCAGGCTGGGGAGG + Intronic
1174064091 20:47852236-47852258 GGCGAAAGATGAGGGTGGCCTGG + Intergenic
1175213301 20:57375367-57375389 GGGCAAAGGGCAGAGTGGGGTGG - Intronic
1175375151 20:58518990-58519012 GGGGACAGGCCAGGGTGGGCTGG + Intergenic
1175492084 20:59386068-59386090 GTCCAAAGGTCAGGTTGGGGTGG - Intergenic
1176102174 20:63369607-63369629 GGCCCTGGGTCCGGGTGGGCAGG - Intronic
1176117830 20:63440703-63440725 GGTCTGAGGACAGGGTGGGCCGG + Intronic
1176151912 20:63595825-63595847 TGGCCCAGGTCAGGGTGGGCGGG - Intronic
1180157893 21:45986853-45986875 GGCCAGAGGGGAGGCTGGGCTGG - Intronic
1180768383 22:18360952-18360974 GGCCAAAGGTCAGTGGCGGGGGG + Intergenic
1182422050 22:30253455-30253477 TGCCAAGAGTCAGGGTGGCCAGG - Intergenic
1183275303 22:36892681-36892703 GGACAAAGGACAGGGAGGACAGG + Intergenic
1183361240 22:37384504-37384526 GGCCAGGGGTCAGGTTGGGAAGG - Intronic
1183581262 22:38727950-38727972 AGCCAGAGGTCAGGATAGGCTGG - Intronic
1183976527 22:41515528-41515550 GCCCCAAGGTGAGGGTGGGGAGG + Exonic
1183981291 22:41542018-41542040 GGGCAGAGGGGAGGGTGGGCTGG - Intronic
1184236075 22:43183682-43183704 GGCCCCAGGTCAAGGTGGGATGG + Intronic
1184418734 22:44367028-44367050 GGCCCAGGGTCAGTGTGGGAGGG - Intergenic
1184433304 22:44454309-44454331 AGCCACAGCTCAGGGAGGGCAGG + Intergenic
1184657530 22:45949332-45949354 GGCCGGAGGGCAGGGTGGGTGGG - Intronic
1184692041 22:46121841-46121863 GCCCCTAGGGCAGGGTGGGCAGG - Intergenic
1184859080 22:47163092-47163114 TGCCAGTGGCCAGGGTGGGCAGG + Intronic
1184869489 22:47226184-47226206 GGCCAAAGGTGGCAGTGGGCTGG + Intergenic
1184924191 22:47625917-47625939 GGGCAGAGGGCAGGGTGGCCAGG - Intergenic
1185156314 22:49195475-49195497 GGGGATAGATCAGGGTGGGCGGG + Intergenic
1185388512 22:50547242-50547264 GGCCAAAGCTCCGGGTGCCCGGG - Intergenic
950741101 3:15052418-15052440 GGCCCACGGTCACTGTGGGCTGG - Exonic
951244747 3:20327818-20327840 GGCCAAAGTTCAGGGTCTGGGGG - Intergenic
953531113 3:43740556-43740578 GGCCTAAGGGCAGGGTGGGTTGG + Intergenic
953658756 3:44874793-44874815 GGCCACAAGTCAGGGTGAGAGGG - Intronic
953889740 3:46743111-46743133 GGACAGAGGTCAGGGTTGGGTGG - Intronic
954625487 3:52019938-52019960 GGCCAAAGGCCAGGCTGGCTTGG + Intergenic
955378124 3:58415139-58415161 GACCAAATGTCAGGGTGTGGGGG + Intronic
961463355 3:127067073-127067095 GCACAGAGGTCAGTGTGGGCAGG + Intergenic
962740392 3:138359088-138359110 GTCCAAAGGTCAGTATTGGCTGG - Intronic
965193862 3:165568469-165568491 GGCGAAAGCTGGGGGTGGGCTGG - Intergenic
966047039 3:175564774-175564796 GGCCAAAGGTCAAGATGGATGGG + Intronic
966471657 3:180296241-180296263 GGACAAAAGTCTGGGTGGACAGG + Intergenic
967691702 3:192481735-192481757 GACCGAACTTCAGGGTGGGCTGG - Intronic
968627616 4:1634253-1634275 GGAGACAGGGCAGGGTGGGCAGG + Intronic
968830063 4:2928703-2928725 GGACAAGGGGCAGGGTGGGGTGG - Exonic
968905831 4:3450080-3450102 GGCCAGAGGGCAGAGAGGGCGGG + Intergenic
969012657 4:4079510-4079532 AGCCCAAGGTCTGGCTGGGCCGG - Intergenic
969271291 4:6105121-6105143 TGCCACAGGTCAGGGCAGGCCGG - Intronic
969674632 4:8608014-8608036 GTCCTAAGGTTAGGGTGGGTTGG - Intronic
971070440 4:23085150-23085172 GGTCAAAAGTGAGGGTGGCCTGG + Intergenic
971985398 4:33815668-33815690 GGCCACTGGTCAGTGTGGGAAGG - Intergenic
973671401 4:53222145-53222167 AAACAAAGGTGAGGGTGGGCGGG - Intronic
974096805 4:57372840-57372862 GGTCAAATGTCAGGCTGAGCTGG - Intergenic
976045798 4:80945745-80945767 GGCCAAAGGAAAGGGGGGTCAGG + Intronic
977220469 4:94332189-94332211 GGAGAGAGGACAGGGTGGGCAGG - Intronic
979810138 4:125026689-125026711 GGGCAAAAGTCACAGTGGGCAGG + Intergenic
979929981 4:126617843-126617865 GGCTGAAGGTGAGGGTGAGCTGG + Intergenic
980137087 4:128868623-128868645 GGGCAAAGATCAAGTTGGGCAGG + Intronic
981181909 4:141756000-141756022 GGCCAGAGCTCAGGGGGGACAGG + Intergenic
981824422 4:148923993-148924015 GGCCAAAAGAAAGGGTGGGGAGG - Intergenic
983626399 4:169805920-169805942 GCCCATAGGTTAGGGTGGGCAGG - Intergenic
983986723 4:174068443-174068465 GCCCAAAGGTCAGAGGGAGCAGG - Intergenic
985777532 5:1852560-1852582 GGCCCACGCTCAGGATGGGCTGG + Intergenic
985998007 5:3607690-3607712 GGCCCTGGGTCAGGGAGGGCAGG + Intergenic
986253693 5:6083768-6083790 GGCAGGAGGCCAGGGTGGGCAGG - Intergenic
986278936 5:6306655-6306677 GGCCAGCGGTCAAGGTGGGGTGG - Intergenic
988817569 5:34849945-34849967 GGTCAAAGGTGAGGGTGGCCTGG + Intronic
992186925 5:74252886-74252908 GGCCAAGGGTATGGGTGGGAGGG - Intergenic
992933822 5:81680088-81680110 GGCCCAAGAACAGGGTGGGGTGG - Intronic
993205300 5:84871179-84871201 ATTCAAAGGTCAGGGTGGGGTGG + Intergenic
993465220 5:88237218-88237240 GGCCAAAGTGCAGGGGAGGCTGG - Intronic
994184983 5:96807412-96807434 GGCCAAAAGGCGGGGTGGGGCGG - Intronic
995833270 5:116376673-116376695 GGCCAAAATTAAGGGTGAGCTGG - Intronic
997468552 5:134104031-134104053 GGCCAGGGCTCAGGGTGGGCCGG - Intergenic
999250492 5:150179653-150179675 AGGCGAAGGTCTGGGTGGGCAGG + Intronic
1004881244 6:20010693-20010715 AGCCAAGGGTCAGGCTGGGCTGG - Intergenic
1005984808 6:30864834-30864856 GTTCAGAGGTCAGGGTGGGAGGG - Intergenic
1006397141 6:33794930-33794952 GGCACAAGGGCAGGCTGGGCGGG + Intronic
1006672005 6:35735472-35735494 GGCCAAGGCTCTGAGTGGGCAGG + Intergenic
1007250749 6:40493229-40493251 GGCAGAAGTTCAAGGTGGGCTGG - Intronic
1007388202 6:41533698-41533720 TGCCCAAGGTCAGGGAGGGTGGG - Intergenic
1007786432 6:44282609-44282631 TGCCAAAGATCTAGGTGGGCAGG - Intronic
1009504188 6:64454076-64454098 GGCCAAAGGTAGGGGTGGAAGGG - Intronic
1012111304 6:95238406-95238428 GGCAGAAGGTCATGGTGGCCTGG + Intergenic
1014963763 6:127720972-127720994 GGCCAAAAGTCAGAGTAGGAGGG - Intronic
1017130751 6:151106563-151106585 GGCCTTAGATCAGGGTGGGGTGG - Intergenic
1019188227 6:170233667-170233689 GGCCAATTGGAAGGGTGGGCAGG + Intergenic
1019308113 7:345974-345996 GACAGATGGTCAGGGTGGGCAGG + Intergenic
1019409878 7:901765-901787 GGCCGGAGGAAAGGGTGGGCGGG - Intronic
1020009239 7:4799494-4799516 TGCCAGAGGTGGGGGTGGGCAGG + Intronic
1021804659 7:24343222-24343244 GGCAAAGGGACAGAGTGGGCCGG - Intergenic
1022603956 7:31790090-31790112 GGCCAAGGGTCAGGGGGTGGGGG + Intronic
1023780761 7:43652860-43652882 TGTCAAGGGTCAGGGTGGGAGGG + Intronic
1023992076 7:45134399-45134421 GGCCAGGGGTCAGGGTGGCAAGG + Intergenic
1024541020 7:50475225-50475247 GATGAAAGGTCAGGGTGAGCTGG + Intronic
1026998269 7:74633725-74633747 TGGCAAAGGTCAAGGTAGGCTGG + Intergenic
1027645423 7:80791215-80791237 GGCCAAACTTAAGGGTAGGCTGG + Intronic
1032021632 7:128409907-128409929 GGCCGCAGCTCAGGGCGGGCGGG + Exonic
1034559847 7:151872806-151872828 GGCTGCAGGTGAGGGTGGGCTGG + Intronic
1035704803 8:1667420-1667442 GGCCACAGGTGAGCGTGGCCTGG + Intronic
1036609606 8:10338327-10338349 GGCCAGAGGCCAGGGTGGAGTGG + Intronic
1036682360 8:10884863-10884885 AGCCAATGCTCAGGGTGGACAGG + Intergenic
1038224508 8:25643480-25643502 GGCAAAAGGTAAGGGAGAGCAGG + Intergenic
1038533622 8:28338308-28338330 GGCTAGAAGTCAGGGTTGGCAGG + Intronic
1039393897 8:37206441-37206463 GGCCAAGGGTCAGGGACTGCAGG + Intergenic
1039415858 8:37393663-37393685 GGCCCAGGGGCGGGGTGGGCGGG - Intergenic
1039769464 8:40668991-40669013 GCCCATAGGTCAGGGGGGTCAGG + Intronic
1039966446 8:42287506-42287528 GGCCAAGCGCCAGGGTGGGTGGG + Intronic
1039990223 8:42481480-42481502 GGCCTAAGCTGGGGGTGGGCAGG + Intronic
1040542530 8:48372862-48372884 AGCCATAGCTCAGGGTGGGATGG - Intergenic
1041172631 8:55160526-55160548 GTCCAAAGGCCAGAGTAGGCAGG + Intronic
1042201355 8:66281989-66282011 GGCCAAAGGACAGGATGGATAGG + Intergenic
1044520155 8:93189635-93189657 GAAAAGAGGTCAGGGTGGGCAGG + Intergenic
1045269403 8:100649417-100649439 GGGCTGGGGTCAGGGTGGGCAGG - Intronic
1046655298 8:116887414-116887436 TCCCAAAGGTCAGGGGTGGCTGG + Intergenic
1047169268 8:122475241-122475263 GCCCAAAGGACAGGGATGGCAGG - Intergenic
1047489718 8:125364516-125364538 GGCCAGAGCTCTGTGTGGGCAGG + Intronic
1047772422 8:128039988-128040010 GGCCAATCCTCAGGGTGAGCAGG + Intergenic
1048441381 8:134462034-134462056 GTCCAAAGGCCAGGCTGAGCTGG + Intergenic
1049056123 8:140238952-140238974 TGCCCAAGGCTAGGGTGGGCTGG + Intronic
1049164694 8:141118691-141118713 GGTGACAGGGCAGGGTGGGCAGG + Intronic
1049189713 8:141280229-141280251 GACCCCAGGACAGGGTGGGCAGG - Intronic
1049252959 8:141598942-141598964 AGCCAGAGGGCAGGGTCGGCAGG - Intergenic
1049350342 8:142160930-142160952 GGCCACAGGGCATGGCGGGCGGG - Intergenic
1049398378 8:142412484-142412506 GGGCAAGGGGCAGTGTGGGCTGG - Intergenic
1049636227 8:143690998-143691020 GCCCACAGGTCTGGGTGGGAAGG - Intronic
1049694792 8:143977845-143977867 GGGGCAAGGTCAGGGTGGTCGGG + Intronic
1053308769 9:37002304-37002326 GGCCCGAGGGCAGGGTGTGCTGG - Intronic
1053449556 9:38181585-38181607 GGGCGAAGGTGAGGGTGGACAGG + Intergenic
1053754413 9:41289708-41289730 TGCCAAAGGTTAGGGTTGGTTGG + Intergenic
1053754556 9:41291967-41291989 TGCCAAGGGTTAGGGTCGGCTGG - Intergenic
1054259933 9:62854043-62854065 TGCCAAAGGTTAGGGTTGGTTGG + Intergenic
1054260076 9:62856273-62856295 TGCCAAGGGTTAGGGTTGGCTGG - Intergenic
1054331835 9:63765965-63765987 TGCCAAAGGTTAGGGTTGGTTGG - Intergenic
1057119802 9:92560968-92560990 GGACAAAGGTCATGGTGGAGGGG - Intronic
1057293394 9:93821175-93821197 GTCTAACAGTCAGGGTGGGCTGG - Intergenic
1057903895 9:98969677-98969699 GGCCCAAGGTCACTGAGGGCTGG + Intronic
1058674603 9:107389662-107389684 GGCCAAAGGGCAGGGTTGGGAGG - Intergenic
1058897562 9:109413453-109413475 GGCCACAGCACAGGGTGGCCAGG + Intronic
1059280287 9:113127091-113127113 GCCACAAGGTCAGGCTGGGCAGG - Intergenic
1059680140 9:116577906-116577928 GACCAGAGATAAGGGTGGGCAGG + Intronic
1060968562 9:127724933-127724955 GGCCCGAGGGCAGGGCGGGCAGG + Intronic
1061282841 9:129607348-129607370 GGGAAAGGGTGAGGGTGGGCAGG + Intergenic
1061539723 9:131271641-131271663 TGCCAAAGGGCAGACTGGGCGGG - Intronic
1061828071 9:133274365-133274387 CGCCAAAGGCCAGGGAGAGCCGG - Intronic
1062562093 9:137146243-137146265 GGACTCAGGACAGGGTGGGCGGG - Intronic
1202799218 9_KI270719v1_random:159089-159111 TGCCAAAGGTTAGGGTTGGTTGG - Intergenic
1188542404 X:31265545-31265567 GACCAAAGTTGAGGGTGGGTAGG - Intronic
1192808345 X:74529177-74529199 GGCCTGAGGTCAGGTTGTGCTGG - Intronic
1195341810 X:103913835-103913857 TGCCATAGCTGAGGGTGGGCAGG - Intergenic
1196315527 X:114218165-114218187 AGCCAAAGAACAGGGTAGGCAGG - Intergenic
1199078985 X:143555606-143555628 GGCCAAAGGTCAGAGCAGGAAGG + Intergenic
1199573060 X:149287550-149287572 TTCCAAAGGACAGAGTGGGCTGG + Intergenic
1199769442 X:150964975-150964997 GCCCAGAGCTGAGGGTGGGCTGG - Intergenic