ID: 906119743

View in Genome Browser
Species Human (GRCh38)
Location 1:43381435-43381457
Sequence AACAGTTTATAGGAGTCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 178}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906119743 Original CRISPR AACAGTTTATAGGAGTCTGA GGG Intergenic
901549533 1:9985495-9985517 AACAGTTTGTGGTAGTCTGATGG + Exonic
902384327 1:16067840-16067862 AACAGCTTAAAGGAGTTGGAAGG - Intronic
903856177 1:26338589-26338611 AAGAGATTATACGAGACTGATGG - Intronic
906119743 1:43381435-43381457 AACAGTTTATAGGAGTCTGAGGG + Intergenic
907963356 1:59304949-59304971 AACAGTTTTTTGGAGTCTTTGGG + Intronic
911485863 1:98504401-98504423 CACAGGTTATAGGAGAGTGAAGG - Intergenic
915689499 1:157674850-157674872 AACAGTTTGGAGGACTCAGAAGG + Intronic
916259498 1:162827087-162827109 AACAGTTTATAAGAGTAATATGG + Intronic
918791452 1:188835872-188835894 AACATTTTATGGGTGTTTGAAGG - Intergenic
918810524 1:189113079-189113101 AACAGTTTTTTGGTGTTTGAGGG - Intergenic
919168241 1:193921735-193921757 AACAGTTAACAGTAGTCTGCAGG + Intergenic
921613618 1:217241201-217241223 AGCAGTTTCCAGGAGTTTGATGG + Intergenic
923562860 1:235054804-235054826 AACAGTTCAGAGGAGAATGAGGG + Intergenic
924919678 1:248614941-248614963 AGCTGTTCATAGTAGTCTGAGGG - Intergenic
1066310386 10:34190540-34190562 AACAGTTTTTAAGAGTGTAAAGG + Intronic
1067276197 10:44836721-44836743 ATTAGTTTTTAGGAGTCTTATGG - Intergenic
1068253560 10:54476718-54476740 AAAGGTTTCTAGAAGTCTGAAGG - Intronic
1069021987 10:63499600-63499622 AACAGTTTAGAGAATACTGAAGG + Intergenic
1069470563 10:68685424-68685446 AACATTTTATAGGTTTCTGTTGG + Intronic
1071906163 10:90176208-90176230 AAATGTTTATTGTAGTCTGAAGG + Intergenic
1074461331 10:113640108-113640130 AACAGTTCATAAGAGGTTGAAGG - Intronic
1075483453 10:122800853-122800875 AACAGTTTTTCTGAGGCTGAGGG + Intergenic
1078028921 11:7728554-7728576 AAAAGTACATAGGAGTGTGAAGG - Intergenic
1079498643 11:21076057-21076079 AACAGTTTTCCAGAGTCTGAGGG + Intronic
1080153270 11:29077971-29077993 AACAGTTTGAAGGACTCAGAAGG + Intergenic
1080304003 11:30817300-30817322 ATAAGTTTATGGGAGTATGATGG + Intergenic
1081108391 11:39100970-39100992 AACAGTTTGGAGGATTCAGAAGG - Intergenic
1085210157 11:74769318-74769340 TACAAATTATAGCAGTCTGATGG - Intronic
1085426629 11:76410594-76410616 AACAGTTCATAGGATGGTGATGG + Intronic
1086119912 11:83294984-83295006 AACAGTTTCTTGGAGGATGAGGG - Intergenic
1086992416 11:93318495-93318517 AACTGTTAATAGAAGCCTGATGG + Intergenic
1087390483 11:97524849-97524871 AAAATTTTATAGGATCCTGATGG - Intergenic
1088340283 11:108757722-108757744 AACAGATTATAAGGGTCAGAAGG - Intronic
1090916201 11:131165268-131165290 AACAGCATAGAGGAGTCTGGAGG - Intergenic
1091717036 12:2785157-2785179 AACTGTTTACAGGACTCTGCTGG - Intergenic
1093913610 12:24775146-24775168 AATAGGTCAAAGGAGTCTGAGGG - Intergenic
1098453039 12:70641902-70641924 AAAAGATTATAGGACTTTGATGG - Intronic
1098935739 12:76477216-76477238 AACAGTTTCTAAGAGTATAAAGG - Intronic
1099377508 12:81909934-81909956 AACAGTTTTTTGGAGTCTTTAGG + Intergenic
1100003534 12:89866832-89866854 ATCTGTTGATAGGACTCTGAGGG - Intergenic
1100087175 12:90925822-90925844 AACTGTTTACAGGACTCTGCTGG + Intronic
1102732126 12:115120940-115120962 AACAGTTTATAGCTTGCTGAAGG + Intergenic
1106998831 13:35520786-35520808 AGAAGTTTAAAGGAGTCTGAGGG - Intronic
1108198811 13:48022145-48022167 ACGTGTTTATAGTAGTCTGATGG - Intergenic
1108248000 13:48536422-48536444 ACCAATTTAATGGAGTCTGAAGG - Intergenic
1111512164 13:89280297-89280319 AATAGTTTATAAGGGTCTCAAGG + Intergenic
1112527790 13:100168795-100168817 ACCAGTTTATGGGAGGCTCATGG + Intronic
1112673550 13:101670888-101670910 TAAAATTTATAGAAGTCTGATGG + Intronic
1116992227 14:51288548-51288570 AACTGTCTATAGGATCCTGATGG - Intergenic
1117125671 14:52621785-52621807 AATAATTTTTAGGAGTGTGATGG - Intronic
1117845192 14:59904337-59904359 TATAGTACATAGGAGTCTGATGG + Intergenic
1118269165 14:64326217-64326239 AAGATTTTATAGAAGTCTGTTGG - Intronic
1119938238 14:78613135-78613157 AACAAGTTAAAGGAGTCAGAGGG - Intronic
1120452546 14:84687133-84687155 AAGAGTTTATAGGGTGCTGATGG + Intergenic
1124136963 15:27043313-27043335 AAGAGTTTATAGGAGACCGTGGG + Intronic
1126986876 15:54321575-54321597 AAAAGTTAATGTGAGTCTGAGGG - Intronic
1127232070 15:57007522-57007544 AACAGTTTATGGCAGGGTGAGGG - Intronic
1127731935 15:61809623-61809645 TACACTTTATTGGAGTCTTATGG - Intergenic
1128804235 15:70518669-70518691 TAGAGTTTAGAGGAGTCTGGAGG - Intergenic
1130008965 15:80132732-80132754 ATCACTTTATACGAGTCTTATGG - Intronic
1135789081 16:25376886-25376908 TACAGCTTACAGGAGTCTAAGGG - Intergenic
1137352153 16:47722961-47722983 AAGAGTTTAAGGGACTCTGAAGG + Intergenic
1138404755 16:56781809-56781831 AACAGTTTATAGGTTACAGAAGG - Intronic
1138746255 16:59366434-59366456 CAAAGTTTATAGCAGGCTGATGG + Intergenic
1141966509 16:87448723-87448745 AACATTTTGTGGGAGGCTGAGGG - Intronic
1143498515 17:7325730-7325752 AACAGTTTAGAGGAGTCCTGAGG + Intronic
1144673969 17:17149868-17149890 ACCAGTTTTTAAGAGTGTGAAGG + Intronic
1145765851 17:27457569-27457591 AACTGTTTAAAGGGTTCTGATGG + Intronic
1149088222 17:52746012-52746034 TAAAGTATATAGGAGCCTGAGGG + Intergenic
1153083653 18:1257900-1257922 AACAGTGTATAAGAGTTTGGGGG - Intergenic
1153375142 18:4368510-4368532 AATAGTTGATGTGAGTCTGAAGG - Intronic
1155638890 18:27988870-27988892 AACATTCTACAGGTGTCTGAGGG + Intronic
1160215737 18:76928436-76928458 AACAGTTTATACCAGTTTCATGG - Intronic
1161016146 19:1984683-1984705 AACAGTTGCCAGGAGGCTGAAGG - Intergenic
1161345827 19:3768343-3768365 ACCAGATTAGAGGAGGCTGAGGG + Intronic
1162052127 19:8040963-8040985 AAGAGTTTATAGGCCTGTGAAGG + Intronic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
1166255313 19:41600220-41600242 AACTGTTTATAGGACTCAGCAGG - Intronic
933069844 2:77843637-77843659 AGCTGTTTATAGTATTCTGATGG - Intergenic
936281094 2:111140430-111140452 AGCAGTTTATAGAAGACTTACGG + Intronic
939128870 2:138210553-138210575 TACAGTTTATAAGATTCTGAAGG + Intergenic
939362424 2:141190132-141190154 GACAGGTTATAGGAGGTTGAGGG - Intronic
941809663 2:169742972-169742994 CACATTTTATAGGACACTGAGGG + Intronic
941972178 2:171363252-171363274 AACATTTTATAGGTTTCTGTGGG - Intronic
942211023 2:173670322-173670344 TAGACTTTATAAGAGTCTGAAGG - Intergenic
942812629 2:180016857-180016879 AACAGTTTACAGGAGAGAGAAGG + Intergenic
942990933 2:182201688-182201710 AACAGTTTGCAGCAGCCTGAAGG - Exonic
943204085 2:184868706-184868728 GACAGCTTTTAGGAATCTGAAGG - Intronic
943386247 2:187206834-187206856 AACAGATTATGAGAGTATGATGG + Intergenic
945023985 2:205602659-205602681 AGCTGTTTATAGCATTCTGATGG + Intronic
945211642 2:207389416-207389438 AACATATGATAGGAGTCTAAAGG - Intergenic
1169470300 20:5879293-5879315 AACAGGTTATGGGAGGGTGAAGG - Intergenic
1169907722 20:10620193-10620215 AACATTTTATTGGAATTTGATGG + Intronic
1173700522 20:45066765-45066787 AAGACTTTATAGGGGACTGATGG + Intronic
1177399292 21:20581572-20581594 CATAGTTTATGAGAGTCTGAGGG - Intergenic
1177402027 21:20617404-20617426 AACTGTTTAGAGGACTCTGCTGG + Intergenic
1177410297 21:20721161-20721183 AACAATGTATAGGAGGCAGACGG - Intergenic
1177591829 21:23180613-23180635 TTCAGTTTATCGGATTCTGAAGG + Intergenic
950102786 3:10368400-10368422 ATGAATTTATAGGAGTCTTAAGG - Intronic
951261825 3:20518716-20518738 AATAGTGTATAGGAGAATGATGG + Intergenic
957470504 3:80652974-80652996 AACAGTTTGAAGGACTCAGAAGG + Intergenic
961211163 3:125127114-125127136 ACCAGTCTTTAGGAATCTGAGGG - Intronic
963163546 3:142177516-142177538 AAAAGTTTGGAGGATTCTGAAGG - Exonic
963248183 3:143082168-143082190 AAGATGTTATAGGAGGCTGAGGG - Intergenic
964648783 3:158988376-158988398 AAGTGTTTATAGTATTCTGATGG + Intronic
964740747 3:159962988-159963010 AGCACTTTATATGAGTCTCATGG + Intergenic
965611205 3:170545900-170545922 AACAGTTTTTGGGAGGCTGCTGG - Intronic
966347154 3:178992487-178992509 ACAAGTTTATTGGGGTCTGAAGG - Intergenic
967616817 3:191579895-191579917 AACCTTTTCTAGGAGTCTGAGGG + Intergenic
967672255 3:192251183-192251205 AACATGTTATATGAGTTTGAAGG - Intronic
967733591 3:192929767-192929789 AAATATTTATAGGAGTCAGAAGG + Intergenic
969029696 4:4202035-4202057 AAAAATTCATAGGAGTCTAATGG - Intronic
972779204 4:42271333-42271355 GACAGGTTATAGGAGGGTGAAGG - Intergenic
973303907 4:48621795-48621817 AACAGTTTATTTGATTCTGTTGG + Intronic
974103972 4:57446716-57446738 AACAGTTTCTAGGGCTCAGAGGG + Intergenic
974811501 4:66952131-66952153 AACATGTTATTGGAGACTGAAGG + Intergenic
975225778 4:71870374-71870396 ACAAGTTTATTGGGGTCTGAAGG - Intergenic
975260714 4:72294797-72294819 AACAGTATTTTTGAGTCTGAGGG + Intronic
976047191 4:80964752-80964774 AAAAGTCTATAGGAGCTTGATGG + Intergenic
977627352 4:99201886-99201908 AACATTTAATAGGAAACTGAGGG + Intergenic
978317721 4:107458212-107458234 AACAGTTTTTTGGAGAATGATGG - Intergenic
979231692 4:118353870-118353892 AACAGTTTTTTGGAGCCTGCGGG - Intergenic
979409125 4:120353132-120353154 AACAGTCTATACCAGTCTGGAGG + Intergenic
980968382 4:139545840-139545862 AGCAGGTTATAGGATTCTGTAGG - Intronic
981797129 4:148608561-148608583 TACAGATTAAAGGAGACTGAAGG - Intergenic
986571749 5:9172621-9172643 AACAGTTTAGAGGTTTCTGTAGG - Intronic
987320541 5:16765112-16765134 AACATATTAGAGGAGTGTGATGG + Intronic
988685545 5:33521903-33521925 CTCAGTTAATAGGAGTCTCATGG - Intergenic
989346402 5:40435172-40435194 AATAATGTACAGGAGTCTGAGGG + Intergenic
990261034 5:54022608-54022630 AACAGGTTATAGAGGTTTGAGGG - Intronic
990786072 5:59421683-59421705 AGCAGTTAGTAGGAGTCTAAAGG + Intronic
991105024 5:62833686-62833708 AACAGTTTGGAGGACTCAGAAGG - Intergenic
991964308 5:72075974-72075996 CACAGTTTAAAGGTGTCTAAAGG - Intergenic
993317230 5:86426319-86426341 AAGAATGTATAGGAGTTTGATGG + Intergenic
993965677 5:94357471-94357493 AACATTTTATAGAAGTTTGGAGG + Intronic
994044425 5:95291903-95291925 AACATGTTAAAGAAGTCTGAAGG + Intergenic
995425929 5:112022764-112022786 GACAGATTATGGGAATCTGAAGG - Intergenic
999250859 5:150181524-150181546 AGCACTTTATGGGAGGCTGAGGG - Intronic
999399041 5:151250313-151250335 AAAAGGTTATATGAGTCAGAGGG - Intronic
999953228 5:156672379-156672401 AACAGTCTCTAGGGGTCTTATGG + Intronic
1004317786 6:14605644-14605666 AACAATTTAAAGGAGACTAAAGG - Intergenic
1004585680 6:16997544-16997566 AACAGGGTATAGCAGTGTGAGGG + Intergenic
1008426874 6:51368839-51368861 AACAGATTATAGGAGTGAAACGG - Intergenic
1009449582 6:63785710-63785732 AAGAGTTTATAGGAATCGGCTGG + Intronic
1010024033 6:71195147-71195169 AACAGTTTATTGCATTCTCATGG - Intergenic
1013454229 6:110315626-110315648 AACACTTTATAGCAGTCTTGTGG - Intronic
1013667601 6:112364523-112364545 AACAGTGTATAAGAGTATAAGGG - Intergenic
1013994222 6:116288871-116288893 CACATTTTATAAGAGTCTTAAGG + Intronic
1015326632 6:131931077-131931099 AACAGCTTATCTGAGGCTGAAGG - Intergenic
1016689531 6:146920773-146920795 AACAGTTTAGAGGTTTCTCAGGG + Intergenic
1017557577 6:155588520-155588542 AAGAGTTTATAGATGTCTGATGG - Intergenic
1018257507 6:161936512-161936534 AACAGTTTTTGGGAGGCTCAAGG + Intronic
1020843131 7:13246552-13246574 AGCATTTTATATGAGTCTCATGG + Intergenic
1026779879 7:73258565-73258587 ACCATTTTATAAAAGTCTGATGG - Intergenic
1027020733 7:74811983-74812005 ACCATTTTATAAAAGTCTGATGG - Intronic
1027067292 7:75133947-75133969 ACCATTTTATAAAAGTCTGATGG + Intronic
1032287136 7:130547763-130547785 AGCACTTCATAGGAATCTGATGG + Exonic
1034704042 7:153124352-153124374 GACTGTATTTAGGAGTCTGATGG - Intergenic
1035951911 8:4031108-4031130 AACAGTTTGGAGGACTCAGAAGG - Intronic
1039930979 8:41988836-41988858 AACAGTTGAGAGGTGACTGAGGG - Intronic
1041406506 8:57505195-57505217 AACAGGTTATAGGAAACTGGAGG + Intergenic
1042157581 8:65862487-65862509 AAGAGTGTAAAGGAGTCTTAAGG + Intergenic
1043559135 8:81470053-81470075 AAAAGTTTATTGGTGTCTAAAGG - Intergenic
1043575793 8:81654609-81654631 AACAATTTCTAGGTATCTGATGG + Intergenic
1048404492 8:134106124-134106146 AACAGTTTAGAGGGCTCAGAAGG + Intergenic
1050649584 9:7761091-7761113 AAAACTTTATATGATTCTGAAGG - Intergenic
1051403050 9:16704643-16704665 AACGGTTTATATTAGTCAGAGGG - Intronic
1051539679 9:18201149-18201171 AACAGTGTTTTGGAGTTTGAGGG + Intergenic
1052701246 9:31940684-31940706 AACAGTTTAGAGGGCTCAGAAGG + Intergenic
1055370876 9:75597705-75597727 AACAGCTTATAAGTGTTTGATGG + Intergenic
1055413664 9:76059134-76059156 AGAAGGTTATGGGAGTCTGAAGG + Intronic
1055858645 9:80722987-80723009 AACAGTTTAGAGGATTCAGGAGG - Intergenic
1056293574 9:85169090-85169112 AAAAGTTACTAGGTGTCTGAAGG - Intergenic
1057630228 9:96713992-96714014 AACAGTGTCCAGAAGTCTGAGGG - Intergenic
1058363834 9:104183850-104183872 AACAGATTGAAGGAGACTGATGG - Intergenic
1186026546 X:5319796-5319818 ACAAGTTTATGGGGGTCTGAAGG + Intergenic
1187432522 X:19237961-19237983 AACAGTTTCTAAGAGTCTTTGGG + Intergenic
1188909539 X:35829552-35829574 ACAAGTTTATAGTAGTCTCAGGG + Intergenic
1188924191 X:36019207-36019229 AACTGTTTACAGGACTCTGCTGG - Intergenic
1191158241 X:57298805-57298827 AGGTGTTTATAGTAGTCTGATGG - Intronic
1191160567 X:57325629-57325651 AGGTGTTTATAGTAGTCTGATGG + Intronic
1191979855 X:66913609-66913631 AACAGTTTTTAGGAGTCCTAGGG - Intergenic
1195530306 X:105946476-105946498 AATAATTTCTAGGAATCTGAAGG - Intronic
1195604472 X:106787457-106787479 AAGAGTTTAGAGGAGTTTGTTGG + Intronic
1199776208 X:151014079-151014101 AACAGTTTAGAGGGCTCAGAAGG - Intergenic