ID: 906121293

View in Genome Browser
Species Human (GRCh38)
Location 1:43393201-43393223
Sequence GTGAAGATCTTCAGGTGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 1, 2: 1, 3: 17, 4: 202}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906121293 Original CRISPR GTGAAGATCTTCAGGTGAGA AGG Intronic
900460452 1:2800123-2800145 GAGCAGAGCTTCAGGTGACAGGG + Intronic
902261169 1:15226009-15226031 GTGAAGAACAGGAGGTGAGAGGG + Intergenic
903239459 1:21973371-21973393 GTGAAGAACTAAAGGTCAGATGG - Intergenic
903243260 1:21998294-21998316 GTGAAGAACTAAAGGTCAGATGG - Intronic
906121293 1:43393201-43393223 GTGAAGATCTTCAGGTGAGAAGG + Intronic
907809267 1:57852170-57852192 ATGAGGATCTTCAGGGGAAAAGG - Intronic
907980953 1:59480335-59480357 GAGCAGATCTTGCGGTGAGAAGG - Intronic
908057446 1:60304868-60304890 GTGAAGCTCCTCAGGAGACAAGG + Intergenic
908882436 1:68747300-68747322 GGAAAGAACTTTAGGTGAGAGGG + Intergenic
909496259 1:76282224-76282246 GTGAGGAATTTCAGGTGAGAGGG + Intronic
910689949 1:89955455-89955477 ATGAAGGTCTTCAGGGAAGAGGG - Intergenic
911867666 1:103049487-103049509 GTGTATCTCTGCAGGTGAGATGG + Intronic
912825976 1:112903623-112903645 GTGAACTTCTTGAGATGAGAGGG - Intergenic
912861347 1:113216583-113216605 GTGAGGATGTTCAGAGGAGAGGG + Intergenic
913116206 1:115699653-115699675 GAGAAGATGTTTAGGGGAGAAGG + Intergenic
915971331 1:160357240-160357262 GCAAAGAGCTTGAGGTGAGATGG + Exonic
918110382 1:181450397-181450419 GTGGAGATTTTCAGGTGAAGGGG + Intronic
920727685 1:208451680-208451702 GTGATGATTTTAAGGTGATATGG - Intergenic
923031446 1:230252123-230252145 CTCAAGAGCTTCACGTGAGAAGG + Intronic
924689307 1:246330252-246330274 ATGAAGATGTTCAGGTTACATGG - Intronic
1064973394 10:21088974-21088996 GTGAAGCTCTAGAGGGGAGATGG + Intronic
1065384076 10:25116497-25116519 GTGAGGATCTTGAGGTTATATGG + Intergenic
1065895397 10:30158923-30158945 GTTAAGTTGTTCAGTTGAGATGG - Intergenic
1066319446 10:34286785-34286807 GTGAAGAACTGCAGGTGAAAAGG + Intronic
1066381222 10:34903324-34903346 TTAAAGATGTTCAGGTGAAAAGG - Intergenic
1067743821 10:48917734-48917756 AGGAAGTTCTTCAGGTGAAAGGG + Intronic
1070588908 10:77787699-77787721 GTGAGGATCTTCAGCTGATCTGG - Intergenic
1075180931 10:120210211-120210233 GTGAAGGTTTTCAGGTGATGAGG - Intergenic
1075204594 10:120436105-120436127 GAGATGAACTTCAGGTAAGATGG + Intergenic
1077802526 11:5555231-5555253 GTAAAGTCCTTCAGGTAAGAAGG + Intronic
1082275659 11:50218609-50218631 GTGTAGATCTATAGGTGAGGAGG - Intergenic
1083593462 11:63908291-63908313 GTGGAGACGCTCAGGTGAGAGGG + Exonic
1086365137 11:86101335-86101357 CTGAAGATCAGCAGGTGAAATGG + Intergenic
1088786513 11:113187000-113187022 GCTAAGAACTTCAGTTGAGAAGG - Intronic
1090522198 11:127491183-127491205 GTGAAGAGCTGAATGTGAGAAGG - Intergenic
1091453405 12:587554-587576 GTGAAGTTCTACAGCTGGGAGGG + Intronic
1091803724 12:3341679-3341701 GTGAATATTTTCAAATGAGAAGG + Intergenic
1092515074 12:9202823-9202845 GTGACGATATTAATGTGAGATGG + Intronic
1095545391 12:43362293-43362315 GTGCAGAACTTCAGGAGAGGAGG + Intronic
1097736346 12:63185805-63185827 GTAAAGACATCCAGGTGAGATGG + Intergenic
1099612265 12:84889000-84889022 ATGAGGATCTTCAAGGGAGAAGG - Intronic
1101597264 12:106178281-106178303 GTCAAGACCATCAGGTGAGAAGG + Intergenic
1105790125 13:23790491-23790513 CTAAAGATCCTGAGGTGAGAAGG + Intronic
1106798391 13:33231276-33231298 GTGAAGATTTTCAGGACAGCAGG + Intronic
1106846721 13:33744847-33744869 ATGAAAATCTTCAGGGGAGGAGG + Intergenic
1107276911 13:38688395-38688417 TTGAAGATCAACAGGTCAGAGGG - Exonic
1109332658 13:60949112-60949134 GTGAAGATGTTTAGTAGAGATGG + Intergenic
1109344444 13:61098476-61098498 ATGAGGGTCTTCAAGTGAGAAGG - Intergenic
1110577552 13:77076853-77076875 ATGAAGATATGCATGTGAGAAGG + Intronic
1110734634 13:78921754-78921776 GTGAAAATTTTCAGATGTGACGG + Intergenic
1111086773 13:83385917-83385939 GTGAATTTTTTCAGGTCAGAAGG - Intergenic
1111463895 13:88582281-88582303 ATGAAGATCATGAGGTGAAATGG - Intergenic
1112708433 13:102099125-102099147 GAGAAGACCCTCAGCTGAGAAGG - Intronic
1112718758 13:102217778-102217800 GTGAAGCGCTACAGCTGAGATGG + Intronic
1113276720 13:108739025-108739047 GTGCATCTCTGCAGGTGAGATGG + Intronic
1113460106 13:110476291-110476313 GTGAAGAGCTCCAGGGGAAATGG - Intronic
1116478320 14:45367037-45367059 ATGAAGGTCTTCAAGGGAGAAGG - Intergenic
1117049118 14:51843156-51843178 GGAAAGGTCTTCAGGGGAGAGGG + Intronic
1118861754 14:69669618-69669640 TTGAAGATGTTTAGGGGAGAAGG - Intronic
1120242603 14:81966647-81966669 GTGAAGATTTTGAGGGTAGAGGG + Intergenic
1120242665 14:81967215-81967237 ATGAGGATCTTCAAGGGAGAAGG - Intergenic
1121005206 14:90486121-90486143 GTGAAGAACTAGAGGGGAGAGGG + Intergenic
1121405608 14:93717628-93717650 GGGAAGAGCTTCCGGTGTGATGG - Intergenic
1122601199 14:102922814-102922836 GTGAAGATCTTCCGAGGAGTGGG + Intronic
1123091954 14:105745880-105745902 GGGCAGATCTGCAGGTGAGCAGG - Intergenic
1123091994 14:105746033-105746055 CAGAAGAGCCTCAGGTGAGAAGG - Intergenic
1126049505 15:44673464-44673486 GTGAAGTTCTTGAGGGGAAAAGG - Intronic
1126086829 15:45018901-45018923 GTGAGTCTCTGCAGGTGAGATGG + Intergenic
1127775766 15:62263361-62263383 GTGAACAGCTTCAAGGGAGAAGG + Intergenic
1130688503 15:86059927-86059949 GAGAAGGTCTTCTGGTTAGAAGG + Intergenic
1131056386 15:89377779-89377801 GTAAGGAGCTCCAGGTGAGACGG + Intergenic
1133851647 16:9510028-9510050 GTGAAGAAGCTCAGGTGAGCTGG + Intergenic
1135063897 16:19293003-19293025 GAGAAGGTCTTCATGGGAGAAGG + Intronic
1135981522 16:27151375-27151397 GTGAAGATCAACAGTTAAGAGGG + Intergenic
1136221230 16:28830466-28830488 GGGCAGATCTTCAAGTGGGATGG + Intronic
1137027322 16:35490070-35490092 GTGAACATCTTCAATTGAGGAGG - Intergenic
1137778218 16:51074192-51074214 GTGAAGCTATGAAGGTGAGAGGG - Intergenic
1139657754 16:68399308-68399330 GTGAAGGTCAGGAGGTGAGAAGG + Intronic
1139743699 16:69057588-69057610 TTGGAGTTCTTCAGGTGACAGGG - Intronic
1142311858 16:89318778-89318800 GTGAAGTTATTCTGGAGAGAGGG + Intronic
1147460542 17:40565373-40565395 GTGAGCCTCTTCATGTGAGAAGG - Intronic
1147553082 17:41458617-41458639 GTGGGGATCTTCAGGAGAGCAGG - Intergenic
1147693569 17:42334085-42334107 GTGAATGTATACAGGTGAGATGG + Intronic
1148346129 17:46904586-46904608 GGGAAGATGTGCAGGTGAGTGGG + Intergenic
1150701335 17:67449143-67449165 GTGACGATCTTCAAGTGACAGGG - Intronic
1151424358 17:74020901-74020923 GTGAATATCTTGAGGTGATGGGG + Intergenic
1152673606 17:81624741-81624763 CTGAAGAGCTTCAGCTGAGCAGG + Intronic
1152987376 18:333116-333138 GTGAAGTTCTTCCAGTGAGGCGG + Exonic
1157853892 18:51085630-51085652 GTGGAGCACTTCAGGTGAAAGGG + Intergenic
1158015685 18:52780752-52780774 GTGAAGGTCTTCAGGGGAGAAGG + Intronic
1158225571 18:55197726-55197748 ATGAAGATCTTCATGTAAGAGGG - Intergenic
1158504523 18:58034747-58034769 TTAAAGATCTTGAGGTGAGAGGG + Intergenic
1161290622 19:3491804-3491826 GTGCAGACCTGCAGGGGAGAGGG + Exonic
1164377559 19:27701889-27701911 GTGAAGATCTTCAGTTTAGTCGG - Intergenic
1164742417 19:30585732-30585754 GGGAAGGTCATCAGGGGAGATGG - Intronic
1164825533 19:31282463-31282485 GTGAAGGCCACCAGGTGAGAGGG + Intronic
1168104944 19:54160869-54160891 CTGCTGATCTCCAGGTGAGACGG - Exonic
925421563 2:3717029-3717051 GAGAAGAGCTTCAGAAGAGAAGG - Intronic
925876687 2:8317319-8317341 GTCAAGGTTTTCAGGAGAGAGGG + Intergenic
928733062 2:34255296-34255318 ATGTAGATTTTCAGGTGAGATGG + Intergenic
929914267 2:46121158-46121180 GTGAAGATACTCTGGTTAGATGG - Intronic
930627740 2:53717578-53717600 GTGAACATCTCCAGATGAAAAGG + Intronic
931146489 2:59525338-59525360 GATAAAATCTTCAGGTGAGGGGG + Intergenic
932184192 2:69677879-69677901 ATGAGGGTCTTCAGGGGAGAAGG - Intronic
935811803 2:106805825-106805847 GGGTAGATCTGCAGGTGAGGAGG + Exonic
937510293 2:122587668-122587690 GAGAATATCTACAGGTAAGAAGG + Intergenic
938646910 2:133341303-133341325 GTCATGATCTTCAGGTGTGTGGG - Intronic
938798271 2:134736764-134736786 ATCAAGATCTTCAGATGAAAAGG + Intergenic
939450294 2:142364901-142364923 GTGAAGATCTGGAGGAGAAATGG + Intergenic
941877292 2:170447053-170447075 ATGAGGGTCTTCAGGGGAGAAGG + Intronic
945462840 2:210131086-210131108 TTGAAGATCCTCAGGTGAACTGG - Intronic
947367099 2:229407779-229407801 TTGAAGAACTGCAGGGGAGAGGG + Intronic
1169945885 20:10987518-10987540 ATGAATAACATCAGGTGAGATGG + Intergenic
1171087332 20:22250134-22250156 GTGAAGATGTTCAGGTTCAAAGG + Intergenic
1174084347 20:47994937-47994959 GGGAAGATGTACAGGTGAGGGGG - Intergenic
1174681094 20:52409205-52409227 ATGTAGTTCTTTAGGTGAGAGGG + Intergenic
1174770991 20:53300207-53300229 GTAATGATCTTTAGGAGAGAGGG + Intronic
1175039623 20:56035905-56035927 GTGAACATCTTTAGGGGTGAGGG + Intergenic
1175590785 20:60190274-60190296 ATGAGGAACTTCAGGGGAGAAGG - Intergenic
1178041376 21:28643954-28643976 ATGAAGAACTGCATGTGAGAAGG + Intergenic
1178195198 21:30337026-30337048 GTGAAGATCTGTAGGGGAGATGG - Exonic
1184499149 22:44861494-44861516 TTGAGGATGCTCAGGTGAGATGG - Intronic
1184949213 22:47828093-47828115 GTGACAATCTTGAGGTCAGAGGG + Intergenic
950528733 3:13540172-13540194 GTGAAGATACTCAGGACAGAGGG + Intergenic
950557580 3:13704743-13704765 GTGGAGACCTTCATGTGAGAAGG + Intergenic
951755363 3:26085490-26085512 ATGAGGATCTTCATGGGAGAAGG - Intergenic
953403184 3:42644784-42644806 GTGGAGATCTGCAGGGTAGATGG - Intronic
953587877 3:44221641-44221663 GTGAAGATCTTTAAGTCAAAAGG - Intergenic
954874825 3:53795109-53795131 GTGCTGATCTGCAGGTGTGATGG + Intronic
955080111 3:55650369-55650391 GTGGTGATCATCAAGTGAGATGG - Intronic
955715825 3:61828727-61828749 GTGAAGACCTCCAGGGGACAGGG + Intronic
956053920 3:65278364-65278386 GTGCAGAACATAAGGTGAGATGG - Intergenic
957233858 3:77558957-77558979 GTGTCAATCTTCAGATGAGACGG - Intronic
957840804 3:85666735-85666757 GTGAAGATCTTCAGGGGAGAAGG + Intronic
958192942 3:90206081-90206103 TTGAAGGTCTTCATGGGAGATGG + Intergenic
958416242 3:93877033-93877055 TTGAAGGTCTTCATGGGAGATGG + Exonic
961125001 3:124409459-124409481 GTGAAGCTCTTCATGCCAGAGGG + Intronic
961332314 3:126149804-126149826 GGGAAGACCTTCAAGAGAGAAGG - Intronic
962686892 3:137856604-137856626 CTTAAGATCTTCAGGGGTGATGG - Intergenic
962711302 3:138088635-138088657 GTGAATATCTGTAGGTGAGTAGG - Intronic
962878237 3:139552415-139552437 CTCAAGATGTTCAGGGGAGAGGG + Intergenic
963080716 3:141391271-141391293 GTGAAGATCGTGTGCTGAGAAGG + Intronic
964764905 3:160170266-160170288 ATGAAGGTCTTCAAGGGAGAAGG + Intergenic
965183896 3:165438345-165438367 TTTATGATCTTCAGGGGAGAAGG + Intergenic
968922596 4:3530432-3530454 GTGAAGTTCTTCGGGGGTGAGGG - Intronic
969238462 4:5884345-5884367 GTGAAGATGATCAGGAAAGAAGG - Intronic
972683918 4:41333277-41333299 ATGAAAATCTTCACGTGATATGG - Intergenic
976000248 4:80365987-80366009 GAGAAGATCTGCAGATGAAAGGG - Intronic
976702812 4:87989695-87989717 TTGAAAATCTTCTAGTGAGATGG + Intergenic
977203297 4:94141450-94141472 ATGAATTTCTTCAGATGAGAAGG + Intergenic
979401448 4:120254625-120254647 GTGTGTATCTTCACGTGAGATGG + Intergenic
980515159 4:133847676-133847698 ATGAAGGTCTTCAGGGGAGAAGG + Intergenic
981344799 4:143662971-143662993 GTGTATTTCTGCAGGTGAGATGG + Intronic
981601706 4:146496505-146496527 ATGAGGGTCTTCAGGGGAGAAGG - Intronic
983112366 4:163768235-163768257 GTGAGGATCTCCAACTGAGAAGG - Intronic
983640820 4:169942575-169942597 GTGAGGATTTTCAGGGGAGGAGG - Intergenic
984519392 4:180784148-180784170 ATGAAGGTCTTCATGGGAGAAGG + Intergenic
984606935 4:181796498-181796520 CTGAAGATCTTCAAGGCAGAGGG + Intergenic
984740627 4:183158015-183158037 GTGAAAATACTAAGGTGAGATGG - Intronic
985052860 4:186010207-186010229 ATGAAGATCATCAAGGGAGAAGG + Intergenic
986313925 5:6573516-6573538 ATCAAGATCTTCAAGAGAGAAGG - Intergenic
987297581 5:16567651-16567673 GAGAAGATCTTCAAGAGAGCTGG + Intronic
987753513 5:22070507-22070529 GTTAAGATCTTCAGCTGATTAGG - Intronic
988042557 5:25908802-25908824 GTGAACATCTACATATGAGAAGG + Intergenic
991971107 5:72142251-72142273 TTTAAGATCTTCCTGTGAGATGG + Intronic
994994233 5:107039191-107039213 ATGAGGGTCTTCAGGGGAGAAGG + Intergenic
995078957 5:108023865-108023887 GTGATAATCTTGAAGTGAGAAGG + Intronic
995083926 5:108086133-108086155 ATGAGGATCTTCAAGGGAGAAGG - Intronic
995083941 5:108086223-108086245 ATGAGGATCTTCAAGGGAGAAGG - Intronic
996271505 5:121610261-121610283 ATGAATAGATTCAGGTGAGAAGG - Intergenic
1000755824 5:165158375-165158397 TTGAAGATTTACAGGTAAGAAGG + Intergenic
1000964238 5:167636134-167636156 GTGAAAATCCTCTCGTGAGAAGG - Intronic
1002187230 5:177460000-177460022 GGGAAGAGCTTCAGGAGAGGCGG + Intronic
1002853355 6:1016184-1016206 TTATAGATCTTCAGGTGGGAGGG - Intergenic
1003801192 6:9669270-9669292 GTGAAGATCTGCAGGAGAGGTGG - Intronic
1004028567 6:11843377-11843399 GTGAAGATCTTGGGGACAGATGG - Intergenic
1005303428 6:24492639-24492661 GACAAGACCATCAGGTGAGAGGG - Intronic
1007872285 6:45053955-45053977 CTGATGGTCTTCAGGGGAGAAGG - Intronic
1009027361 6:58016047-58016069 ATGAGGGTCTTCAGGAGAGAAGG - Intergenic
1009940722 6:70284628-70284650 GAAAAGATCCTCAGGTGACAAGG + Intronic
1010465264 6:76160629-76160651 GGGAAGATCTTCAAGGCAGAGGG + Intergenic
1011101938 6:83731852-83731874 ATGAAGATCTTCAAGGGAAAAGG + Intergenic
1011192412 6:84744649-84744671 GGGAAGAACTTCAGTTCAGAGGG - Intronic
1011547689 6:88499242-88499264 GGGAAGATCCTCAGGTGAAAGGG + Intergenic
1012488304 6:99747392-99747414 ATTAAGATCTTCAGGTGTGGTGG + Intergenic
1013922359 6:115422089-115422111 ATGAAGTGCTTCAGGTGAAAAGG - Intergenic
1017693927 6:156995046-156995068 GTGAGGATCTTCAGCAGAGGAGG + Intronic
1018567637 6:165172319-165172341 GTGAAGATCTTCAGGAAAAATGG - Intergenic
1019226732 6:170517435-170517457 GTCAACATCTCCAGATGAGAAGG + Intergenic
1020951055 7:14678185-14678207 GTCAAGAACTTCAGGTGATTAGG + Intronic
1021504828 7:21370384-21370406 GTGCAGGTCCTCAGGTGTGAGGG + Intergenic
1023480134 7:40625309-40625331 GTGAAGATTTTCAGGGCAGTAGG + Intronic
1027560624 7:79724436-79724458 GTGAAGGTCTTCAGAAGAGAAGG + Intergenic
1032627367 7:133606391-133606413 GTGAAGATATTCAGGATATAAGG - Intronic
1033832667 7:145272325-145272347 GTGAGAATCTTCAGGGAAGAGGG + Intergenic
1038590985 8:28837628-28837650 GTCCAGATCGGCAGGTGAGAGGG - Exonic
1039229206 8:35424647-35424669 ATGAAGCTCTTCAGGTGATCTGG + Intronic
1044089896 8:87987000-87987022 TTGATGAACTTGAGGTGAGACGG + Intergenic
1045385061 8:101664673-101664695 TGGAAGATCTTTAGGAGAGAGGG + Intronic
1047301012 8:123613413-123613435 TTGAGGATCTTCAAGGGAGAAGG + Intergenic
1047483285 8:125305072-125305094 GGGAAGATCTTCAGAAGTGAAGG + Intronic
1048458844 8:134602904-134602926 GTGAAGATTTTGAGCTGAGTGGG + Exonic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1058203445 9:102072427-102072449 GTGAAAATTTTCAGGTGAGGGGG - Intergenic
1059951885 9:119473449-119473471 GAGATGATCTTCAGGTTAAAGGG + Intergenic
1060116686 9:120946990-120947012 ATGAAGATCATCACCTGAGATGG - Intergenic
1185505088 X:627411-627433 GGAAAGGTCTTTAGGTGAGAGGG + Intronic
1185956531 X:4497125-4497147 ATGAAGTTCTTCAGGGAAGAAGG - Intergenic
1186748159 X:12592072-12592094 ATGAAGGTCTTCAAGGGAGAAGG - Intronic
1188024620 X:25195252-25195274 ATGAGGATCTCCAGCTGAGAGGG - Intergenic
1189104126 X:38219870-38219892 GCGAAGAGCTTCAGGGGAGTAGG - Intronic
1189701987 X:43721256-43721278 GTGAAGGCCTTGAGGTGAGAAGG + Intronic
1190496160 X:51030307-51030329 GTGAAGAGCTGCATGTGTGAGGG - Intergenic
1191071420 X:56404583-56404605 GTGGACATCTTCAGGTGTCATGG + Intergenic
1192733812 X:73829104-73829126 ATGTTGATCTTCAGGTGGGAAGG + Intergenic
1193983899 X:88217402-88217424 GTGAATCTCTTCAGATGAGGAGG - Intergenic
1194566000 X:95488622-95488644 GAGAAGCTCTGCAGCTGAGATGG - Intergenic
1195164857 X:102209285-102209307 ATTAAGATCTTGAGGTGGGAAGG + Intergenic
1195194001 X:102477806-102477828 ATTAAGATCTTGAGGTGGGAAGG - Intergenic
1196927392 X:120647050-120647072 GGGAAGATCTTTAGTTCAGAGGG + Intergenic
1197874486 X:131088875-131088897 GTAAAGATCTGAAGGTAAGAAGG + Exonic
1200874408 Y:8138207-8138229 GTGAGAATCTGCACGTGAGATGG + Intergenic