ID: 906124092

View in Genome Browser
Species Human (GRCh38)
Location 1:43415975-43415997
Sequence CCCAGTAGGTCCCCTGAGTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 6, 3: 17, 4: 216}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906124092_906124103 21 Left 906124092 1:43415975-43415997 CCAGACTCAGGGGACCTACTGGG 0: 1
1: 0
2: 6
3: 17
4: 216
Right 906124103 1:43416019-43416041 GGTGACAGCTGATCTTGGGCTGG 0: 2
1: 0
2: 0
3: 12
4: 193
906124092_906124099 0 Left 906124092 1:43415975-43415997 CCAGACTCAGGGGACCTACTGGG 0: 1
1: 0
2: 6
3: 17
4: 216
Right 906124099 1:43415998-43416020 CCGGAAGGTAGGCGTCTCCATGG 0: 1
1: 0
2: 0
3: 4
4: 73
906124092_906124100 16 Left 906124092 1:43415975-43415997 CCAGACTCAGGGGACCTACTGGG 0: 1
1: 0
2: 6
3: 17
4: 216
Right 906124100 1:43416014-43416036 TCCATGGTGACAGCTGATCTTGG 0: 2
1: 0
2: 0
3: 18
4: 176
906124092_906124102 17 Left 906124092 1:43415975-43415997 CCAGACTCAGGGGACCTACTGGG 0: 1
1: 0
2: 6
3: 17
4: 216
Right 906124102 1:43416015-43416037 CCATGGTGACAGCTGATCTTGGG 0: 2
1: 0
2: 0
3: 17
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906124092 Original CRISPR CCCAGTAGGTCCCCTGAGTC TGG (reversed) Exonic
900304908 1:2000965-2000987 CACAGTAGGTTCCCTGGGTAGGG + Intronic
900889361 1:5438375-5438397 CCCAGTAGGGCCTCTGTGTGGGG + Intergenic
902148064 1:14420398-14420420 GCCAGCTGGGCCCCTGAGTCGGG - Intergenic
902886079 1:19405874-19405896 CCCATTAGGACCCGAGAGTCTGG + Intronic
903461665 1:23524982-23525004 GCCAGGAAGTCCCCTGGGTCTGG - Intronic
904031001 1:27533372-27533394 CCCAAGAGGTCCCCAAAGTCAGG + Intergenic
904197840 1:28799362-28799384 CACAGTAGGTCCTATGAGTCAGG + Intergenic
906124092 1:43415975-43415997 CCCAGTAGGTCCCCTGAGTCTGG - Exonic
906691074 1:47793041-47793063 CCCAGCAGGTGCCCTGCGGCTGG + Intronic
909066287 1:70939443-70939465 CCCAGTAGGGCCCCTGTGTGGGG + Intronic
912819290 1:112854425-112854447 GCCAGTTGGGCTCCTGAGTCTGG - Intergenic
913459026 1:119063902-119063924 CCCAGTAGGTACACTGTGTGGGG - Intronic
916218507 1:162419894-162419916 CCCAGAGGGTACCCGGAGTCCGG - Intergenic
920048156 1:203146933-203146955 CCCAGTAGGCCCCAGGAGTGAGG + Intronic
920604785 1:207371320-207371342 GCCAGCTGGTCTCCTGAGTCAGG - Intergenic
921169665 1:212535374-212535396 CACACTACATCCCCTGAGTCAGG - Intergenic
923051074 1:230391946-230391968 CCCAGCAGGACTCCTGTGTCGGG - Intronic
1063304850 10:4887684-4887706 CCCAGCAGGTCCCCTGGTCCTGG + Intergenic
1063566360 10:7174806-7174828 CCCAGCAGGTCACCTGGTTCCGG - Intronic
1064685503 10:17856844-17856866 CTCAGTAGGTCACCGCAGTCGGG + Intronic
1064782368 10:18856671-18856693 CCCAGCAGGTACCCCGAGTCCGG + Intergenic
1065226098 10:23545297-23545319 CCCAGTAGGGCCTCTGTGTGGGG - Intergenic
1066249995 10:33624136-33624158 CCCAGTGTGTCCCATGAGTGAGG + Intergenic
1068645167 10:59457990-59458012 CCCAGCTGGTCCCCTGACTAGGG - Intergenic
1069351380 10:67531157-67531179 CCCAGTAGGTACTCTGTGTGAGG - Intronic
1070919976 10:80178466-80178488 GCCAGAAGGTCCCCAGAGACAGG - Intronic
1073458762 10:103653563-103653585 GCCAGTAGGTCCACAGAGTCAGG + Intronic
1076271339 10:129155010-129155032 AACAGTAGGTCCCCTGAGCCTGG + Intergenic
1079181927 11:18201401-18201423 CCCAATAGGTACTCTGTGTCGGG + Intronic
1079730509 11:23934762-23934784 CCCAGCTGGGCTCCTGAGTCTGG - Intergenic
1081329626 11:41788137-41788159 CCCAGCTGGGCTCCTGAGTCTGG - Intergenic
1085174395 11:74473689-74473711 CACAGTAGGCCGCCTGACTCTGG - Intergenic
1085378249 11:76087985-76088007 CCCAGTAGCTCCCTGGGGTCAGG + Intronic
1085518499 11:77124823-77124845 CCCAGTGGGTGGCCTGACTCTGG - Exonic
1085941805 11:81213972-81213994 CCCAGGAGGGCCCCTGTGTGGGG + Intergenic
1087125998 11:94626207-94626229 CCCAGTAGGGACTCTGTGTCGGG + Intergenic
1091747874 12:3004040-3004062 ACCAGAAGGCCCCCAGAGTCAGG - Intronic
1093299768 12:17439658-17439680 CCCAGTGGGGCCCCTGTGTGAGG + Intergenic
1093793805 12:23286380-23286402 GCCAGCTGGTCTCCTGAGTCTGG + Intergenic
1094302424 12:28979883-28979905 CCCAGAAGGTCGCCTAAGCCTGG + Intergenic
1095095366 12:38145008-38145030 GCCAGTGGGTACCCCGAGTCCGG - Intergenic
1096960213 12:55569890-55569912 CCCAGTAGGGACTCTGAGTGGGG + Intergenic
1103506567 12:121445153-121445175 TCCTGGAGGACCCCTGAGTCTGG - Intronic
1105403650 13:20116464-20116486 CCGAGAAAGTCCCCTGAGGCTGG + Intergenic
1105868120 13:24479428-24479450 CCCAGCTGGGCTCCTGAGTCTGG + Intronic
1106331468 13:28743446-28743468 CCAAGTAGGACCCCTGAGACTGG + Intergenic
1107247918 13:38319747-38319769 CCCAGCGGGTACCCCGAGTCCGG + Intergenic
1108409154 13:50130115-50130137 CCCCGTTTCTCCCCTGAGTCGGG - Intronic
1109416369 13:62046443-62046465 GCCAGCTGGGCCCCTGAGTCAGG - Intergenic
1110598032 13:77340406-77340428 CCTAGTAGGACCCCAGATTCTGG + Intergenic
1111196260 13:84877275-84877297 CACAGTGGGTACCTTGAGTCTGG - Intergenic
1111403317 13:87769389-87769411 CCCAGTAGGTACTCTGTGTGGGG + Intergenic
1115508763 14:34119189-34119211 GCCAGTATGGCTCCTGAGTCTGG + Intronic
1117797399 14:59408593-59408615 CCCAGGAGCTTCCCTGATTCTGG + Intergenic
1121045386 14:90784104-90784126 CCCAGCAGGACACTTGAGTCTGG + Intronic
1121104012 14:91269263-91269285 CTCAGGAGGTGCCCTGACTCAGG - Intergenic
1121891290 14:97593625-97593647 CCCAGTTGGTCTTTTGAGTCAGG - Intergenic
1122449955 14:101797615-101797637 CGCAGTAGGTCAAGTGAGTCAGG - Intronic
1124032528 15:26024440-26024462 CCCAGTGTGTCCACTGAGCCTGG + Intergenic
1125304194 15:38291445-38291467 CCCAGTAGGGACTCTGTGTCGGG + Intronic
1128732519 15:70030862-70030884 CCCAGGAGGACCCCTGATTGGGG - Intergenic
1130905824 15:88240375-88240397 CACAGAATGTCCCCTGCGTCAGG - Intronic
1130964593 15:88687433-88687455 CCCAGAAGATCACTTGAGTCCGG + Intergenic
1133946855 16:10355926-10355948 CCCAGTAGCCTCCCCGAGTCTGG - Intronic
1135075937 16:19393607-19393629 CCCAGTGGGTACCCTGAGTCTGG + Intergenic
1136519616 16:30787094-30787116 CCCAGTCCGTCCCCCGAGGCAGG - Exonic
1136556374 16:31010087-31010109 CCCAGGAGGGCCCCGGGGTCTGG - Intronic
1138257569 16:55580069-55580091 CCCAGTCTTTCCCCTGAGGCTGG + Intronic
1139514256 16:67444072-67444094 CCGAGCAGGTCCCCTGGGCCAGG - Intronic
1144088467 17:11831950-11831972 CCCTGCTGGTCCCCTGAATCGGG - Intronic
1144656975 17:17042962-17042984 CCCAGTCGCTCACCTGCGTCAGG - Exonic
1144667374 17:17111378-17111400 CCCAGCAGGTGTCCTGAGGCAGG + Intronic
1145830973 17:27915879-27915901 CCCACTGTGTCCCCTGAGGCTGG - Intergenic
1146723096 17:35137070-35137092 CCCAGTCGGTCACCTGTCTCCGG - Exonic
1147587290 17:41659797-41659819 CCCAGCAGGTACCCAGAGCCAGG + Intergenic
1148780061 17:50116293-50116315 CCCATTAGGTCCCATGAAGCAGG - Intronic
1149308679 17:55373422-55373444 CCCAGTAGGTACTCTGTGTGGGG - Intergenic
1149602781 17:57904081-57904103 CCCAGTGGGAGCCCTGCGTCTGG + Intronic
1151500955 17:74488585-74488607 CCCAGTAGGGACCCTGTGTGGGG + Intergenic
1151518807 17:74614154-74614176 CCCAGGAGGTGCCCTGGATCTGG - Intronic
1151836149 17:76584284-76584306 CCAAGAAGATCCCTTGAGTCTGG - Intronic
1152849967 17:82627709-82627731 GCCAGTGGGTCGCCTGAGACCGG - Intronic
1153388469 18:4527644-4527666 CCCAGCGGGTACCCCGAGTCCGG + Intergenic
1157516954 18:48317992-48318014 CTCAGTAGGGCCCCTGAGATGGG - Intronic
1160693289 19:470139-470161 CCCAGGAGGTGTCCTGAGACTGG + Intronic
1161982535 19:7637396-7637418 CCCTTTGGGTCCCCGGAGTCCGG - Intronic
1166252711 19:41582431-41582453 CCCAGTAGGGACTCTGTGTCGGG + Intronic
1166282999 19:41807633-41807655 CCCAATCTGTCCACTGAGTCTGG - Intronic
1166668693 19:44697230-44697252 CCCAGTACGTGCTCTGAGGCAGG + Intergenic
925059536 2:880452-880474 GCAGGCAGGTCCCCTGAGTCGGG + Intergenic
927007626 2:18866639-18866661 CCCAGTAGGGACCCTGGGTGGGG - Intergenic
927409251 2:22806048-22806070 CCCAGTAGGGACCCTGTGTCAGG + Intergenic
929306738 2:40371889-40371911 CCCAGTTGGTCTCCTGGGCCAGG + Intronic
931154672 2:59614804-59614826 CCCAGTAGGTACTCTGTGTAGGG + Intergenic
932902128 2:75712024-75712046 GCCAGTTGGGCTCCTGAGTCTGG + Intergenic
933066809 2:77808138-77808160 CCCAGTGGGTACCCCAAGTCCGG - Intergenic
933418910 2:82023196-82023218 CCCAGTGGGTACCCTGAGTCTGG - Intergenic
933419855 2:82031232-82031254 CCCAGTGGGTACCCTGAGTCTGG - Intergenic
934082595 2:88482002-88482024 CCCAGAAGGAGCCTTGAGTCAGG - Intergenic
937527536 2:122789036-122789058 CCCAGTAGGGACTCTGTGTCGGG - Intergenic
937715155 2:125024234-125024256 CCCAGTGGGTACCCTGAGTCCGG + Intergenic
939087641 2:137740773-137740795 GCCGGCAGATCCCCTGAGTCAGG + Intergenic
939498263 2:142949323-142949345 CCCAGTAGGTACACTGTGTGGGG + Intronic
940345268 2:152622126-152622148 CCCGGTAGGTCACCTGAGACAGG + Intronic
941424038 2:165320450-165320472 CCCAGTAGGGACCCTGTGTTGGG + Intronic
942132917 2:172898467-172898489 CCCAGTGGGTCCACAGAGTGAGG - Intronic
942320356 2:174730753-174730775 CGCAGGAGGTCCCCGGAGGCAGG - Intergenic
942540270 2:177008300-177008322 GCCAGCTGGTCTCCTGAGTCTGG + Intergenic
942830989 2:180237390-180237412 CCCAGCGGGTACCCGGAGTCTGG - Intergenic
943284553 2:185981184-185981206 CCCAGTTAGTCCCATCAGTCAGG - Intergenic
943833208 2:192487900-192487922 CCCAGCGGGTACCCCGAGTCCGG - Intergenic
944101334 2:196030979-196031001 CCCAGTAGGGACTCTGAGTGGGG + Intronic
1173139652 20:40470916-40470938 GCCTGGAGGTGCCCTGAGTCTGG + Intergenic
1175515748 20:59568743-59568765 CCCAGAGGGTCACCTGTGTCTGG + Intergenic
1176230507 20:64030329-64030351 CCCAGGAGCTCTCCTGTGTCCGG + Intronic
1179332093 21:40413203-40413225 CCCAGTAGGTACTCTGTGTGGGG - Intronic
1179878894 21:44285401-44285423 CCCAGGCGGGCCCCTGAGTAGGG + Intergenic
1181539494 22:23565850-23565872 CCCAGGAGGACCCCAGAGCCCGG - Intergenic
1181547874 22:23613553-23613575 CCCAGCAGGACCCCAGAATCAGG + Intronic
1183541019 22:38429518-38429540 CCCCGTAGGTCCCATGAGGTAGG - Intronic
1184812371 22:46844809-46844831 CCCAGTAGGACCCCTGGGCCTGG - Intronic
1185351418 22:50341596-50341618 CCCTGTAGGTCTCAGGAGTCAGG + Intergenic
949731414 3:7117541-7117563 CCCAGGAGGGCCCCAGAGTCAGG - Intronic
950668368 3:14510885-14510907 CCCAGTAGGTCTCCTCTGCCAGG + Intronic
950857747 3:16121295-16121317 CCCCCAAGGTCCCCTGAATCCGG - Intergenic
950880285 3:16317666-16317688 CTCACTAGGTCACCTGAGTAAGG + Intronic
952885363 3:38008481-38008503 CCCACCAGGGCCCCTGAGCCAGG + Exonic
954041082 3:47887658-47887680 CCCAGCTGGGCTCCTGAGTCTGG + Intronic
957056088 3:75444345-75444367 GCCAGCTGGTCTCCTGAGTCTGG - Intergenic
957160270 3:76601317-76601339 CCCAGTAGGGACCCTGTGTGGGG + Intronic
959729983 3:109590474-109590496 CCCAGTAGGAACCCTGTGTGTGG + Intergenic
962769990 3:138603039-138603061 CCCAGTAGGGACCCTGTGTGGGG - Intergenic
963375393 3:144457610-144457632 CCCATGGGGTCCCCTGAGGCTGG - Intergenic
963592971 3:147286390-147286412 CCCAGTAGGGACCCTGTGTGGGG + Intergenic
964526001 3:157615855-157615877 CTCAGTAGGTACCATGTGTCAGG - Intronic
966425391 3:179775429-179775451 GCCAGTTGGGCTCCTGAGTCGGG - Intronic
967695712 3:192528571-192528593 CCCAGTAGGGACCCTGTGTGGGG + Intronic
967902111 3:194465246-194465268 CCCAGCAGTTTCCCTGAGTTTGG + Intronic
968520188 4:1031593-1031615 CCCAGCAGGACCCCTGAATTCGG - Intergenic
969282425 4:6179627-6179649 CCCAGCAGTGGCCCTGAGTCAGG + Intronic
971377027 4:26063880-26063902 GCCAGTTGGGCTCCTGAGTCTGG - Intergenic
974748176 4:66102999-66103021 CCCAGTAGGGACTCTGTGTCGGG - Intergenic
976306544 4:83565694-83565716 CCCGGTGGGTACCCCGAGTCCGG + Intronic
976377875 4:84365433-84365455 TCCAGTAGTTCCCTTGAGTGAGG - Intergenic
978855765 4:113392945-113392967 TCCGGTAGGTCTACTGAGTCAGG - Intergenic
979126607 4:116980760-116980782 CCCAGCGGGTACCCCGAGTCCGG - Intergenic
980051847 4:128047469-128047491 GCCAGTTGGGCTCCTGAGTCTGG - Intergenic
981029387 4:140108837-140108859 CCTGGTAGGGCCCCTGAGTCAGG - Intronic
983135020 4:164068804-164068826 GCCAGCTGGGCCCCTGAGTCTGG + Intronic
983327431 4:166274578-166274600 CCCAGCGGGTACCCCGAGTCCGG - Intergenic
987792150 5:22581595-22581617 CCCAGTAGGTACTCTGTGTGGGG - Intronic
989346877 5:40439110-40439132 GCCAGCAGGGCTCCTGAGTCTGG + Intergenic
990345349 5:54865527-54865549 GCCAGTTGGGCTCCTGAGTCTGG + Intergenic
991204855 5:64038812-64038834 CCCAGTAGGGTCTCTGAGTGGGG - Intergenic
993690743 5:90996589-90996611 CCCAGTAGGGACTCTGTGTCGGG - Intronic
994304109 5:98181057-98181079 CCCAGTACCAGCCCTGAGTCTGG + Intergenic
995326336 5:110893937-110893959 GCCAGCAGGGCTCCTGAGTCTGG - Intergenic
996531169 5:124528677-124528699 CCCAGTTGCTCTCCTGAGGCAGG - Intergenic
1001542702 5:172550560-172550582 CACAGTAGAGCCCCTGAGGCCGG + Intergenic
1003404302 6:5815968-5815990 CCCAGAAGGTCTCATGACTCTGG + Intergenic
1004437419 6:15609972-15609994 CCCAGTAGGTCCCAGAACTCCGG - Intronic
1005596128 6:27380977-27380999 GCCAGCTGGGCCCCTGAGTCTGG - Intronic
1005707368 6:28469263-28469285 GCCAGTTGGACTCCTGAGTCTGG - Intergenic
1005759887 6:28958295-28958317 CCCAGCTGGGCTCCTGAGTCTGG + Intergenic
1007169112 6:39850037-39850059 CCCACCAGGTCCCCTGGGGCTGG - Intronic
1009503182 6:64442920-64442942 CCCAGTAGGGACTCTGTGTCAGG - Intronic
1009816934 6:68748731-68748753 CCCAGTAGGGCCTCTGTGTGGGG + Intronic
1009946522 6:70347408-70347430 CCAGGTAGGGCCCCTGGGTCAGG - Intergenic
1010045119 6:71432799-71432821 CACAGTAGGACCCCTGAGCCCGG - Intergenic
1011338275 6:86284728-86284750 GCCAGTTGGGCTCCTGAGTCTGG - Intergenic
1011919023 6:92547812-92547834 CCCAGTAGGGACTCTGTGTCGGG - Intergenic
1012578148 6:100829141-100829163 TCCAGTTGGGCTCCTGAGTCTGG - Intronic
1012690741 6:102308040-102308062 CCCAGTAGGGACCCTGTGTGGGG + Intergenic
1013552571 6:111222789-111222811 CCCAGAAGGTCCCTTGACACTGG - Exonic
1014101603 6:117517507-117517529 CCCAGTAGGTACTCTGTGTGGGG + Intronic
1015067676 6:129050985-129051007 CCCTCTAGGTCCTCTGAATCAGG - Intronic
1015351579 6:132225750-132225772 CCCAGTAGGGACTCTGTGTCGGG - Intergenic
1018032084 6:159849374-159849396 CCCAGTAGGGCCTCTGTGTGGGG - Intergenic
1018832189 6:167451652-167451674 CACAGTAGGTGCCTTGAGTTGGG - Intergenic
1018920369 6:168168195-168168217 CCCCCTGGGTCCCCTGAGGCTGG - Intergenic
1019427474 7:984341-984363 CCCCTTAGGTCCCCTCAGGCCGG - Intronic
1020137604 7:5595437-5595459 CTCAGCAGGTCCCCTTAGTAGGG - Intronic
1020939216 7:14509780-14509802 CCCAGCAGGTACCCCGAGTCTGG - Intronic
1021513720 7:21461107-21461129 GCCAGCAGGGCTCCTGAGTCTGG - Intronic
1023113432 7:36837609-36837631 CCCTGAAGGACCCCTGAGTATGG - Intergenic
1024226703 7:47330899-47330921 CCCTGTAGGACCCGTGAGGCTGG - Intronic
1026742783 7:72989693-72989715 CCTAGCAGGACCCCTGAGTTTGG - Intergenic
1027028896 7:74874398-74874420 CCTAGCAGGACCCCTGAGTTTGG - Intergenic
1027100952 7:75375385-75375407 CCTAGCAGGACCCCTGAGTTTGG + Intergenic
1028192262 7:87867028-87867050 CCCAGTGGGTACCCCAAGTCTGG - Intronic
1030786633 7:113671070-113671092 CCCAGTAGGTTCTCTGTGTGGGG - Intergenic
1031145759 7:117995269-117995291 CCCAGTAGGGACCCTGTGTGAGG - Intergenic
1034188195 7:149195387-149195409 CCCGGTAGGTCCCCGCAGGCGGG + Intergenic
1037172798 8:15913363-15913385 CCCAGTATTCCCCCTGAGGCTGG - Intergenic
1037425529 8:18750953-18750975 GCCAGCTGGTCTCCTGAGTCTGG - Intronic
1038139057 8:24822715-24822737 CCCAGTAGGGACCCTGTGTGGGG - Intergenic
1040787072 8:51178618-51178640 CCCAGAGGGTACCCTGAGTCTGG + Intergenic
1042200831 8:66278313-66278335 CCCTGGATGACCCCTGAGTCAGG - Intergenic
1043709964 8:83403397-83403419 GCCAGCTGGTCTCCTGAGTCTGG + Intergenic
1044633392 8:94300243-94300265 GCCAGTTGGGCTCCTGAGTCTGG - Intergenic
1044702888 8:94980343-94980365 CCCAGTAGCTCCTTTGAGCCTGG - Intronic
1047194943 8:122712806-122712828 CCCAGTAGGGACTCTGAGTGGGG - Intergenic
1047253709 8:123200014-123200036 CCCAGTAGCTCCCATAAGACAGG - Intronic
1049389581 8:142360912-142360934 CCCAGTAGGGCCTCTGAGGCAGG + Intronic
1049403534 8:142441536-142441558 ACCAGTATGTGCCCAGAGTCAGG + Intergenic
1049403548 8:142441609-142441631 ACCAGTATGTGCCCAGAGTCAGG + Intergenic
1050255645 9:3789549-3789571 CCCAGTAGGGACTCTGTGTCGGG - Intergenic
1050660319 9:7877062-7877084 CCCAGTAGGGCCTCTGTGTGGGG - Intronic
1051305006 9:15699954-15699976 GCCAGTTGGGCTCCTGAGTCTGG - Intronic
1052468235 9:28857461-28857483 CCCTGTAGGTGACCTGAGGCTGG - Intergenic
1056571189 9:87816722-87816744 TCCAGTGGGTCTCCTGAGTCAGG + Intergenic
1057429041 9:94977767-94977789 CCCGGTAATTCCACTGAGTCTGG + Intronic
1057511218 9:95680781-95680803 GCCAGTTGGGCTCCTGAGTCTGG + Intergenic
1057531167 9:95847719-95847741 CCCAGTAAGTCCCCTCCTTCAGG + Intergenic
1058168482 9:101649434-101649456 CCCAGTGGTTCCCATGAGACAGG + Intronic
1058230366 9:102417415-102417437 CCCAGTAGGGGCCCTGTGTGAGG - Intergenic
1058799439 9:108530569-108530591 GCCAGTGGGGCTCCTGAGTCTGG + Intergenic
1060297723 9:122354729-122354751 CCCAGTGGGCCCTCAGAGTCAGG - Intergenic
1061057796 9:128233505-128233527 GCCAGTTGGCCTCCTGAGTCAGG - Intronic
1061130825 9:128706803-128706825 GCCAGTGGGTCCCCGGAGCCAGG + Exonic
1061538381 9:131263854-131263876 GCCTGCAGGTTCCCTGAGTCTGG - Intronic
1188936879 X:36186801-36186823 CCCAGTAGTGGCCCAGAGTCAGG - Intergenic
1189346193 X:40243206-40243228 GCCAGAAGGTCCCCAGGGTCGGG - Intergenic
1194201581 X:90958503-90958525 CCAGGTAGGTCCCCTGGCTCAGG + Intergenic
1194602622 X:95940929-95940951 CCCAGTAGGATCCCAGAGCCTGG + Intergenic
1195454292 X:105051118-105051140 CCCAGTAGGTCCCCACATTCAGG - Intronic
1196582766 X:117395130-117395152 GCCAGCTGGTCTCCTGAGTCTGG + Intergenic
1196781390 X:119387495-119387517 CCCAGCTGGGCTCCTGAGTCTGG - Intergenic
1196793906 X:119487774-119487796 ACCAGTTGGGCTCCTGAGTCTGG - Intergenic
1197675207 X:129322539-129322561 CTCAGTACGTTCCCAGAGTCTGG + Intergenic
1199868760 X:151877601-151877623 TCCAGTAGGTACTCTGAGTGGGG + Intergenic
1200547421 Y:4533958-4533980 CCAGGTAGGTCCCCTGGCTCAGG + Intergenic
1201776467 Y:17671239-17671261 CCCAGTGGGTACACTGACTCTGG + Intergenic
1201783215 Y:17745357-17745379 CCCAGTGGGTACCCTGAGTCTGG - Intergenic
1201818338 Y:18160630-18160652 CCCAGTGGGTACCCTGAGTCTGG + Intergenic
1201825089 Y:18234753-18234775 CCCAGTGGGTACACTGACTCTGG - Intergenic
1201863228 Y:18622551-18622573 CCTAGCACGTACCCTGAGTCTGG + Intergenic
1201870094 Y:18697827-18697849 CCTAGCACGTACCCTGAGTCTGG - Intergenic
1202174576 Y:22085606-22085628 CCCAGTGGGTACCCCGAATCTGG - Intronic
1202544369 Y:25974760-25974782 CCCAGTGGGTACCCCGAATCTGG + Intergenic