ID: 906125173

View in Genome Browser
Species Human (GRCh38)
Location 1:43423125-43423147
Sequence GGTGGGGGAAACGCAGCCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 133}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906125173_906125189 27 Left 906125173 1:43423125-43423147 CCTGCGGCTGCGTTTCCCCCACC 0: 1
1: 0
2: 1
3: 14
4: 133
Right 906125189 1:43423175-43423197 AGGTGAAACGAAAAGGGCTAGGG 0: 1
1: 0
2: 1
3: 10
4: 161
906125173_906125177 -8 Left 906125173 1:43423125-43423147 CCTGCGGCTGCGTTTCCCCCACC 0: 1
1: 0
2: 1
3: 14
4: 133
Right 906125177 1:43423140-43423162 CCCCCACCGGGTACAAAGCAAGG 0: 1
1: 0
2: 0
3: 9
4: 73
906125173_906125191 29 Left 906125173 1:43423125-43423147 CCTGCGGCTGCGTTTCCCCCACC 0: 1
1: 0
2: 1
3: 14
4: 133
Right 906125191 1:43423177-43423199 GTGAAACGAAAAGGGCTAGGGGG 0: 1
1: 0
2: 0
3: 4
4: 100
906125173_906125184 20 Left 906125173 1:43423125-43423147 CCTGCGGCTGCGTTTCCCCCACC 0: 1
1: 0
2: 1
3: 14
4: 133
Right 906125184 1:43423168-43423190 ACGCCCAAGGTGAAACGAAAAGG 0: 1
1: 0
2: 0
3: 6
4: 56
906125173_906125182 7 Left 906125173 1:43423125-43423147 CCTGCGGCTGCGTTTCCCCCACC 0: 1
1: 0
2: 1
3: 14
4: 133
Right 906125182 1:43423155-43423177 AAGCAAGGAGCCAACGCCCAAGG 0: 1
1: 0
2: 0
3: 11
4: 120
906125173_906125188 26 Left 906125173 1:43423125-43423147 CCTGCGGCTGCGTTTCCCCCACC 0: 1
1: 0
2: 1
3: 14
4: 133
Right 906125188 1:43423174-43423196 AAGGTGAAACGAAAAGGGCTAGG 0: 1
1: 0
2: 1
3: 14
4: 204
906125173_906125185 21 Left 906125173 1:43423125-43423147 CCTGCGGCTGCGTTTCCCCCACC 0: 1
1: 0
2: 1
3: 14
4: 133
Right 906125185 1:43423169-43423191 CGCCCAAGGTGAAACGAAAAGGG 0: 1
1: 0
2: 0
3: 5
4: 67
906125173_906125190 28 Left 906125173 1:43423125-43423147 CCTGCGGCTGCGTTTCCCCCACC 0: 1
1: 0
2: 1
3: 14
4: 133
Right 906125190 1:43423176-43423198 GGTGAAACGAAAAGGGCTAGGGG 0: 1
1: 0
2: 0
3: 7
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906125173 Original CRISPR GGTGGGGGAAACGCAGCCGC AGG (reversed) Exonic
900227473 1:1539987-1540009 GGTGGGGGGAGCGCAGGCCCGGG + Intronic
900370917 1:2331800-2331822 GGCGGGAGAGGCGCAGCCGCGGG - Intronic
900541443 1:3205007-3205029 GGAAGGGGAAACGCAGGCCCGGG + Intronic
900777428 1:4595415-4595437 GAAGGAGCAAACGCAGCCGCTGG - Intergenic
900970131 1:5987465-5987487 GGTGGGGCAGAGGCAGCAGCAGG + Intronic
901430416 1:9210760-9210782 GGTGGTGGAAAGACAGCCACAGG - Intergenic
902078344 1:13804592-13804614 GGGGGGGGAAATGATGCCGCTGG + Intronic
904642334 1:31939787-31939809 GGTGGGGGAGAAGCACCCACGGG - Intronic
906125173 1:43423125-43423147 GGTGGGGGAAACGCAGCCGCAGG - Exonic
907934084 1:59026529-59026551 GGTGTGGGCAACTCAGCTGCGGG - Intergenic
914833659 1:151189858-151189880 GGTGGGTGAATCGGAGCCGGGGG - Intronic
921384021 1:214551702-214551724 GGTGGGGGAGCCGTGGCCGCCGG - Intronic
922440928 1:225653962-225653984 TCTCGGGGAAACGCAGTCGCCGG + Intergenic
922471512 1:225880019-225880041 GGAGGGGGAAGAGGAGCCGCAGG - Intronic
924064582 1:240208416-240208438 GGTGGGGGAATCCCAGCACCAGG - Exonic
1063477799 10:6343991-6344013 GGTAGGGGAAAGGGAGCCCCTGG + Intergenic
1064137563 10:12764007-12764029 GGTGGGGGAGAGGCAGGCTCAGG - Intronic
1071818902 10:89260643-89260665 GGTGGGGAAAACACAGCCAAAGG - Intronic
1072139219 10:92574591-92574613 CGTGGGGGAAATTCAGACGCAGG + Intergenic
1074889408 10:117722660-117722682 TGTAGGGGAGACGCAGCTGCAGG + Intergenic
1075373564 10:121958612-121958634 GTTGGGGGAAAAGCAGCAGCTGG + Intronic
1076881943 10:133243867-133243889 GGCTGGGGAGACGCAGCCGCAGG + Intergenic
1077038663 11:507592-507614 GGGGGCGGAATCGCAGGCGCGGG + Intergenic
1078934593 11:15940041-15940063 GGTGGGAGAAACACTGCAGCTGG - Intergenic
1083186729 11:61021973-61021995 GGTGGGGCAGACTCAGCGGCAGG + Intergenic
1083595567 11:63917040-63917062 GGCGGGCGGAGCGCAGCCGCGGG + Intergenic
1083747743 11:64744932-64744954 GGTGGGGGTGGCGCAGCCGGCGG - Intronic
1083776491 11:64896643-64896665 GGTGGGGGCAGGGCAGCCTCGGG - Intronic
1084591613 11:70093840-70093862 GGTGGTGGAGACGCAACCTCGGG + Intronic
1089518834 11:119050435-119050457 GGTGGGAGCCACGCAGCCTCAGG - Intronic
1089814196 11:121158004-121158026 GGTGCGGAAGACGCCGCCGCCGG - Exonic
1089970264 11:122687731-122687753 GGTGGGGGAAATGCAGAGGCTGG - Intronic
1092673224 12:10886565-10886587 GGTGGGTGAAAGGGAGACGCAGG + Intronic
1097265097 12:57739904-57739926 GGTGGGGGACACGGAGCAGACGG - Intronic
1097712870 12:62934613-62934635 CGTAGGGGAAACGCAGGGGCAGG + Exonic
1104000651 12:124857761-124857783 GGTGGGGGAAGCCCAGCAGCAGG + Intronic
1104245281 12:127034260-127034282 GGTGGGGGAAACGTGGCGACTGG - Intergenic
1112504535 13:99968324-99968346 GGTGGGGCCCACGCGGCCGCCGG + Intronic
1113655579 13:112066530-112066552 GGGGGAGGAAACGCAGCCCCTGG - Intergenic
1113684437 13:112272525-112272547 TGTGGTGGACACGCAGCTGCAGG - Intergenic
1114525778 14:23366200-23366222 GGGGAGGGAAGGGCAGCCGCGGG - Intergenic
1116366907 14:44077825-44077847 GGTGGGGGAAAAGTAGCTCCAGG - Intergenic
1120953083 14:90060623-90060645 GGTGGGAGCACCGCAGCCCCGGG + Intergenic
1120997554 14:90428062-90428084 GGTGGAGGAAGCGGAGCTGCCGG - Intergenic
1121018012 14:90560128-90560150 GATGGGGGAAAGGCAGGCACAGG - Intronic
1121287532 14:92748196-92748218 GGAGGGGGAAACTGAGGCGCGGG - Intronic
1123173479 14:106396585-106396607 GGTGGGGGGAAATCAGCTGCAGG - Intergenic
1123806447 15:23878294-23878316 GTTGGAGGAAACGCAGACACAGG - Intergenic
1124955815 15:34359652-34359674 GGTGGGGTGAACCCAGCAGCAGG + Exonic
1125021066 15:34987714-34987736 AGTGGGGCAGAAGCAGCCGCCGG - Intronic
1125727059 15:41873554-41873576 GGTGGAGGAGAAGCGGCCGCTGG - Exonic
1127384743 15:58458340-58458362 GGTGGGGGAGGCTCAGCTGCTGG - Intronic
1127578298 15:60313807-60313829 AGTGGGGGAAATGCAGGCTCAGG - Intergenic
1127715674 15:61646854-61646876 GATGGGGGAAACGGAGGCGCTGG + Intergenic
1128233187 15:66049535-66049557 GGTGGGGAAAACGCTTCCACAGG - Intronic
1132618412 16:853287-853309 GGTGGGGGAACCGCCCCCCCAGG + Intergenic
1133069383 16:3235547-3235569 GGTGGGGGGAGCGCGGGCGCTGG - Intronic
1133801639 16:9090470-9090492 GGAGGGGGGCGCGCAGCCGCAGG + Intergenic
1135228226 16:20680368-20680390 GGTGGGGGAAGCTCAGGCACTGG - Intronic
1139413536 16:66786860-66786882 GGTGGGGGTAGGGCAGCCTCAGG - Intronic
1140462122 16:75148515-75148537 GGTGGGGGAAGGGCGGCCACCGG - Intronic
1142336080 16:89490310-89490332 GGCCCGGGAAACGCGGCCGCGGG - Exonic
1146022563 17:29292726-29292748 GGAGCGGGAAACGCGGCCGCTGG + Intronic
1148388529 17:47253790-47253812 GCTGCGGGAAAAGCGGCCGCGGG + Intergenic
1148954258 17:51340683-51340705 GGTGGGGCAAAAGCAGCCAGAGG - Intergenic
1150345109 17:64398548-64398570 GGTGGGGGAAATGGAACGGCCGG - Intronic
1152467873 17:80475969-80475991 GGAGGGGGAACCGGAGCCGAGGG + Intronic
1153886546 18:9473135-9473157 GGTGGGAGAGAAGCAGCCTCAGG + Intergenic
1158607251 18:58906564-58906586 GGTGTGGGAAATGCAGCTCCGGG + Intronic
1160535814 18:79590771-79590793 AGTGTGGGAAAGGCAGCTGCAGG - Intergenic
1160853808 19:1206919-1206941 GGTGGTGGACCCGCAGCAGCTGG + Exonic
1162493282 19:11007904-11007926 GGAGGAGGAAGAGCAGCCGCAGG + Exonic
1162818625 19:13210082-13210104 GGTGGGGGATACCCAGGCACTGG + Intronic
1163356466 19:16815085-16815107 GGTGGGGGCAATGAAGCCACTGG - Exonic
1165735851 19:38175119-38175141 GGTGGGGGAAACTGAGGCCCAGG - Intronic
1166495895 19:43302925-43302947 GATGGGGGAAACTCAGCAGGAGG - Intergenic
1168287475 19:55341871-55341893 GGTGAGGGCAAGGCAGGCGCGGG - Exonic
925987944 2:9231143-9231165 GATGGGGGAAAGGCAGTGGCTGG + Intronic
926243530 2:11105469-11105491 GGTGTGGGAGAGGCAGCCGCCGG + Intergenic
927151112 2:20196725-20196747 GGAGGGGCAGACACAGCCGCCGG + Intergenic
927512865 2:23655232-23655254 GGTGTGGGAGACGCAGCAACAGG - Intronic
927518344 2:23685021-23685043 GGCTGGGGAAAAGCAGCCCCGGG - Intronic
929544916 2:42849391-42849413 GGAGGGGGAAGCGCAGCCTTTGG + Intergenic
931921244 2:67018430-67018452 GGTGGGGCACTGGCAGCCGCAGG - Intergenic
933766002 2:85710200-85710222 GGTGGGGGGACCCCAGGCGCTGG - Intergenic
937284543 2:120741760-120741782 GGTGGGAGGGCCGCAGCCGCGGG - Intronic
944451770 2:199850993-199851015 GGCCGGGGCAGCGCAGCCGCCGG - Exonic
945179100 2:207073837-207073859 AGTGGGGAAAACACAGCCCCTGG - Intergenic
948262599 2:236615178-236615200 GGTGGGGCACAGGCAGCTGCAGG - Intergenic
1172994379 20:39059231-39059253 TGGGGGAGATACGCAGCCGCAGG - Intergenic
1173955860 20:47032025-47032047 GGTAGGGGAAATACAGCCTCAGG + Intronic
1175868608 20:62195838-62195860 TGTGGAGGAAACGGAGGCGCTGG + Exonic
1175929316 20:62486132-62486154 GGTGGGGTAACCGCAGCCACAGG - Intergenic
1176586874 21:8595694-8595716 GGGGGGGGAAAAGCCGCGGCGGG - Intergenic
1179632105 21:42685029-42685051 TGTGGGGGAAACGCAGGCCTAGG - Intronic
1180824038 22:18851031-18851053 GGTGAGGGAAGGGCTGCCGCTGG - Intronic
1180901626 22:19377214-19377236 GGTGGGGGAGAGGTAGCCACAGG - Intronic
1181124464 22:20694185-20694207 GGTGAGGGAAGGGCTGCCGCTGG - Intergenic
1181188699 22:21123517-21123539 GGTGAGGGAAGGGCTGCCGCTGG + Intergenic
1181210500 22:21286976-21286998 GGTGAGGGAAGGGCTGCCGCTGG - Intergenic
1181343933 22:22203438-22203460 GGTCGGGGAACCTCAGCCTCTGG - Intergenic
1181650409 22:24256144-24256166 GGTGAGGGAAGGGCTGCCGCTGG - Intergenic
1182415239 22:30217089-30217111 GGTGGGGGAAGGGCAGACCCAGG + Intergenic
1182845845 22:33430401-33430423 GGTTGGGGAAAGGCAGCTGAGGG - Intronic
1183367851 22:37416760-37416782 GGTGGGGGAAGGGCTGCTGCAGG - Intronic
1184241363 22:43212731-43212753 GGTGGGGAAAACGCAGCAGCCGG + Intronic
1184531564 22:45059380-45059402 GGTGGTTGAAAGGCAGCTGCAGG + Intergenic
1203216447 22_KI270731v1_random:8454-8476 GGTGAGGGAAGGGCTGCCGCTGG + Intergenic
1203274179 22_KI270734v1_random:76935-76957 GGTGAGGGAAGGGCTGCCGCTGG - Intergenic
956210595 3:66798090-66798112 GGTGGGGGACACGCCGCTGAGGG + Intergenic
958768891 3:98402745-98402767 GGTAGAGGAAATGCAGCTGCGGG - Intergenic
961379899 3:126490275-126490297 CGTGGGGGCAAAGCAGCAGCTGG - Intronic
972542945 4:40055956-40055978 GCCGGTGGAACCGCAGCCGCTGG - Intergenic
975673174 4:76802035-76802057 GGTAGGGGAATCGCAGCCGGGGG - Intergenic
977607335 4:98995978-98996000 GGAGGAGGAAACGCGGCCGGGGG - Intronic
981720879 4:147800178-147800200 AGTGGGGGAAACGTAGTCTCAGG + Intronic
985129731 4:186727020-186727042 GGCGTGGGAAACGCCGCCGGAGG - Intergenic
985611878 5:893646-893668 AGTGGGGGGAACTCAGCGGCGGG + Intronic
997239370 5:132295303-132295325 GTTGGGGGAAGCGCAGCCCCAGG + Intronic
997752172 5:136357051-136357073 GGTGGGGGACGCGCTGCTGCTGG - Exonic
998135853 5:139674149-139674171 GCAGGGAGAAACGCAGCCCCAGG - Intronic
1000014693 5:157266451-157266473 GGCGGGGGAGCCGCAGCAGCAGG + Intronic
1005755793 6:28923973-28923995 GGTGGGGTTTACGCTGCCGCCGG - Exonic
1007369397 6:41416505-41416527 GGTGGAGGGAACGGGGCCGCAGG - Intergenic
1010112674 6:72258788-72258810 GGTTGGAGAAATGCAGCCACAGG + Intronic
1011640359 6:89411960-89411982 GCTGGGGAAGCCGCAGCCGCAGG - Exonic
1029514413 7:101016814-101016836 GATGGGGGAGAAGCAGCCGGTGG + Intronic
1031420952 7:121551051-121551073 GGTGGGGGAAGCCCAGCCAGAGG - Intergenic
1034082445 7:148291986-148292008 GGTGAGGCAAACACAGCAGCAGG + Intronic
1035018711 7:155788012-155788034 GGTGGGGGAAACAGAGACCCAGG - Intergenic
1035225754 7:157431220-157431242 TGTGGTGGAAACGCAGCCAATGG + Intergenic
1035397764 7:158546425-158546447 GGTGCTGGAATCACAGCCGCCGG + Intronic
1036561430 8:9903249-9903271 GGTGCGGGACAGGCAGCCGGAGG + Intergenic
1036788986 8:11705137-11705159 GGTGGGGGACCCGCGGCCGATGG + Intronic
1043016886 8:74949906-74949928 GGTGAGGGAAAAGCAGCTGGCGG + Intergenic
1046669789 8:117044822-117044844 GGTGGGGGAAATACTGCTGCAGG + Intronic
1047191318 8:122681488-122681510 GGTGGGGAAAATGCAGCCGGAGG - Intergenic
1048719807 8:137310859-137310881 TGTGGGAGAAACGCCGCCCCGGG + Intergenic
1049373230 8:142277523-142277545 GGTGGGGGCATCCCAGCTGCAGG - Intronic
1050106311 9:2170102-2170124 GGTGGGAGACAGGCAGCCACTGG - Intronic
1057171654 9:92966545-92966567 GGTGGGGGCACCGCAGACTCAGG + Intronic
1057183127 9:93040448-93040470 GGTTGGGGAAAGGGAGCCACTGG + Intergenic
1057213966 9:93218135-93218157 TGTGGGGGCAGGGCAGCCGCAGG + Intronic
1057708197 9:97412549-97412571 CGTGGGGGAAATGCAGCAGCGGG + Intronic
1060187328 9:121571693-121571715 GGTGGGGGATCCGCAGCCACTGG + Intronic
1062240428 9:135534660-135534682 GGTGGGGGAGACACAGCCATAGG - Intergenic
1187008452 X:15254892-15254914 GGTGGCTGAAAAGCAGCCCCAGG - Intronic
1188137285 X:26505131-26505153 GGTGGGGGAATCCCAGCACCAGG - Intergenic
1198212619 X:134529882-134529904 TGTGGGGGAAAGGCACCCACTGG - Intergenic