ID: 906126200

View in Genome Browser
Species Human (GRCh38)
Location 1:43428392-43428414
Sequence GGGCTGAGAGGACCAGGACT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 360}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906126200_906126212 7 Left 906126200 1:43428392-43428414 CCAAGTCCTGGTCCTCTCAGCCC 0: 1
1: 0
2: 2
3: 50
4: 360
Right 906126212 1:43428422-43428444 TTCAGCAGCAGCATGGAGGAGGG 0: 2
1: 0
2: 8
3: 56
4: 429
906126200_906126214 21 Left 906126200 1:43428392-43428414 CCAAGTCCTGGTCCTCTCAGCCC 0: 1
1: 0
2: 2
3: 50
4: 360
Right 906126214 1:43428436-43428458 GGAGGAGGGTGCTGAACCTCGGG 0: 1
1: 0
2: 0
3: 21
4: 239
906126200_906126207 0 Left 906126200 1:43428392-43428414 CCAAGTCCTGGTCCTCTCAGCCC 0: 1
1: 0
2: 2
3: 50
4: 360
Right 906126207 1:43428415-43428437 TGGGCCCTTCAGCAGCAGCATGG 0: 1
1: 2
2: 2
3: 31
4: 335
906126200_906126213 20 Left 906126200 1:43428392-43428414 CCAAGTCCTGGTCCTCTCAGCCC 0: 1
1: 0
2: 2
3: 50
4: 360
Right 906126213 1:43428435-43428457 TGGAGGAGGGTGCTGAACCTCGG 0: 1
1: 0
2: 1
3: 26
4: 271
906126200_906126208 3 Left 906126200 1:43428392-43428414 CCAAGTCCTGGTCCTCTCAGCCC 0: 1
1: 0
2: 2
3: 50
4: 360
Right 906126208 1:43428418-43428440 GCCCTTCAGCAGCAGCATGGAGG 0: 1
1: 0
2: 0
3: 41
4: 273
906126200_906126211 6 Left 906126200 1:43428392-43428414 CCAAGTCCTGGTCCTCTCAGCCC 0: 1
1: 0
2: 2
3: 50
4: 360
Right 906126211 1:43428421-43428443 CTTCAGCAGCAGCATGGAGGAGG 0: 1
1: 2
2: 2
3: 43
4: 543

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906126200 Original CRISPR GGGCTGAGAGGACCAGGACT TGG (reversed) Exonic
900105870 1:980792-980814 GGGCTGCGAGGAGGAGGACGTGG - Exonic
900304808 1:2000353-2000375 GGGTTCGGAGGACCAGGACATGG + Intronic
900637365 1:3672580-3672602 GGGGTGAGGGGTCCAGGGCTGGG - Intronic
900992343 1:6103902-6103924 GGACTGAGGGGGCCAGGGCTGGG - Exonic
901074592 1:6545591-6545613 GGTCTGTGAAGTCCAGGACTGGG + Intronic
901530903 1:9851919-9851941 GGGGTGAGAGCAGCAGGACAGGG - Intronic
901821503 1:11833171-11833193 GGCCTGAGAGCCCTAGGACTGGG - Intronic
902575107 1:17372648-17372670 GGGCTGTGAGGAGCAGGCCAGGG + Intronic
902851038 1:19156953-19156975 TCTCTGAGAGGACCAGGAGTAGG - Intronic
903454971 1:23481255-23481277 GGGCTGCGAGTCCCAGGACAGGG + Intronic
904269766 1:29342339-29342361 GGGTTGAAAAGACCAGGGCTAGG - Intergenic
904488583 1:30844180-30844202 GTGCTGAGAGGAGCAGGAAGAGG - Intergenic
906126200 1:43428392-43428414 GGGCTGAGAGGACCAGGACTTGG - Exonic
906653808 1:47533561-47533583 GGGCTGCGAGGACAAGGAGGAGG + Intergenic
907560867 1:55386153-55386175 GGGCAGAGAGGAAAAGAACTCGG + Intergenic
908586312 1:65573744-65573766 GGGCTGAGAGGAGGGGGAATTGG + Intronic
909412182 1:75367535-75367557 TGGCTCAGAGGACCTGGAGTTGG + Intronic
912947500 1:114097112-114097134 GGGCTGGGAGTCCCAAGACTTGG - Intronic
914449495 1:147778187-147778209 GCTCTGAGAGTCCCAGGACTGGG + Intergenic
914761486 1:150602363-150602385 GGAAGGAAAGGACCAGGACTTGG + Intronic
914878666 1:151530802-151530824 GGCCTGAGAGGACAGGGGCTTGG + Intronic
916530216 1:165649417-165649439 GGAGTGAGAGGAGCAGGACATGG - Intronic
917455650 1:175183515-175183537 AGGGTGAGGGGACCAGGACCCGG + Intronic
918093355 1:181315908-181315930 GGGCTGAGGGGAGAAGGCCTGGG + Intergenic
919725522 1:200880291-200880313 GGGGTGATAGGGGCAGGACTGGG + Intergenic
920201096 1:204260073-204260095 TCGCAGAGAGGACCAAGACTAGG - Intronic
920776013 1:208937970-208937992 GGGCTAAGAGCACAAGGATTGGG - Intergenic
921721621 1:218478494-218478516 GGGCTGAGATGACCAGTCCATGG - Intergenic
922159589 1:223068851-223068873 GGGCTGAGAGGAAAAGCAGTGGG + Intergenic
922336840 1:224624785-224624807 GGGCTGGGAGGACCAGGTCCCGG + Intronic
922608532 1:226907054-226907076 GGGGTGAGAGGACATGGCCTGGG - Intronic
922695223 1:227728105-227728127 GGGCTGGGAGAACAAGGACCTGG + Intergenic
923327847 1:232896799-232896821 GGGCTGAGAGGCCCAACCCTTGG - Intergenic
924450812 1:244177385-244177407 GAGAGGAGAGGACCAGGAATTGG - Intergenic
1063697217 10:8348464-8348486 CGGGTGAGATGACCAGAACTTGG + Intergenic
1064138263 10:12768893-12768915 GGGCTGAGAGTAGCAGTCCTGGG - Intronic
1064139005 10:12774488-12774510 GGGGTATGTGGACCAGGACTTGG + Intronic
1067479915 10:46587906-46587928 GGGCTGTGAGGACCAGGAGCCGG - Intronic
1067614822 10:47753891-47753913 GGGCTGTGAGGACCAGGAGCCGG + Intergenic
1067794208 10:49308921-49308943 GGGCACAGAGGCCGAGGACTGGG + Intronic
1068585924 10:58798494-58798516 GGGCTGGGTGTACCAGAACTTGG - Exonic
1069403602 10:68075242-68075264 GGGCGGAGAGCACCAGGGGTGGG + Exonic
1069776818 10:70932164-70932186 GGGCTGAGAGGCCCAGGCCTTGG + Intergenic
1069865308 10:71498750-71498772 GGGCTGCGAGGACCAGTCATAGG - Intronic
1070554765 10:77518990-77519012 GAGCTGAGAGGTGCAGGGCTGGG - Intronic
1070559986 10:77559050-77559072 GGGCTGGGCTGACCAGGACACGG - Intronic
1071630230 10:87213854-87213876 GGGCTGTGAGGACCAGGGGCTGG + Intergenic
1073147346 10:101289572-101289594 GAGCTGAGGGGGCCAGGACTGGG - Intergenic
1073423289 10:103441155-103441177 GGGCTGAGAGGACCGGGTATGGG + Intronic
1075054662 10:119208143-119208165 GGGCTCAGAGAATCTGGACTTGG + Intronic
1075078951 10:119370047-119370069 GGGCTGAGATGGACAGGACATGG - Intronic
1075971416 10:126657310-126657332 GGGCTGGGAGGAGGAGGAATGGG - Intronic
1075985924 10:126784863-126784885 GGGCTGAGAGGACCTGTGCAGGG + Intergenic
1076727931 10:132421963-132421985 GAGCTGGGAGGCCCAGGAGTGGG + Intergenic
1076800789 10:132827141-132827163 TGGCTCAGTGGCCCAGGACTGGG - Intronic
1076842779 10:133054495-133054517 GGACAGAGAGGACCAGGAATGGG + Intergenic
1076869638 10:133187045-133187067 GGGCTGTGAGCATCAGGACTGGG - Intronic
1077228488 11:1448513-1448535 GGCCGGATAGGACCAGGGCTCGG + Intronic
1078021079 11:7656333-7656355 GGGATGACAGGACAAGGACAGGG + Intronic
1078886213 11:15502662-15502684 TGGCAGAGAGGATCAGAACTGGG + Intergenic
1079287469 11:19150069-19150091 GGCCTTGGAGGAACAGGACTTGG - Intronic
1080238285 11:30097734-30097756 AGGCTGAGAGAAACAGGATTGGG + Intergenic
1081071323 11:38613265-38613287 GGGCTGAGAGGCACAGGATCAGG + Intergenic
1081535987 11:43996575-43996597 GGGGTGACAGGACCAGGTTTTGG + Intergenic
1081665483 11:44914694-44914716 TGGCTGAGAGGAACAGTACTCGG - Intronic
1081871185 11:46383216-46383238 GGGCTGCTGTGACCAGGACTAGG + Intronic
1083759869 11:64810007-64810029 GGGCCGAGAGGAGCCGGACCTGG - Exonic
1084012406 11:66359899-66359921 GGGCTGACTGGACCAGGGCTGGG - Intronic
1084972286 11:72778506-72778528 GTGCTGAGAGGATCAGGAGTGGG + Intronic
1085018557 11:73190976-73190998 AGACAGATAGGACCAGGACTTGG + Intergenic
1085457665 11:76674321-76674343 GGGCTTGCAGGACCAGGCCTGGG + Intergenic
1087022289 11:93615553-93615575 GTGCTGTGGGGACCAGGACTGGG - Intergenic
1088598665 11:111457458-111457480 GGGCTGAGAGGAAGGGGACTGGG - Intronic
1088893254 11:114060374-114060396 GGGCGGAGGGGAGCAGGACTGGG + Intronic
1089269926 11:117295111-117295133 AGGGTGAGAGGAACAGGGCTTGG - Exonic
1089535798 11:119160292-119160314 GGGCTGAGAAGAGCAGGAAGCGG - Exonic
1090937146 11:131353471-131353493 GGGCTGAGATGGCCAGGCCATGG - Intergenic
1090977909 11:131691736-131691758 GGGCTGAGCGGAGCGGGGCTGGG + Intronic
1090981856 11:131729586-131729608 GGGCTGGGAGGACGGGGAATGGG - Intronic
1092445882 12:8556716-8556738 GGTCTGAGAGCCCCAGGGCTGGG - Intergenic
1093905667 12:24689444-24689466 TGGGTGAGAGGAGCAGGACATGG + Intergenic
1095878458 12:47106921-47106943 AGGCAGAAAGGAACAGGACTTGG - Intronic
1095955751 12:47804882-47804904 GGGGAGGGAGGACCAAGACTGGG - Intronic
1096263919 12:50109367-50109389 GGGTAGAGTGGACCAGGAGTGGG + Intronic
1096869705 12:54585602-54585624 GGGCTGAGAGGAGTAGGATGAGG + Intronic
1097282406 12:57852968-57852990 GGGCGGAGAGCACCCGGGCTAGG - Intergenic
1098596160 12:72274151-72274173 AGGCTGAGAGGACCGGGACGGGG + Intronic
1100364483 12:93907168-93907190 TGGCAGAGAGGAGCAGCACTGGG - Intergenic
1101255436 12:102972756-102972778 GGGCTGAGAAGAGGAGCACTTGG - Intergenic
1102329748 12:112018980-112019002 GGGCTGGGAGGAGGAAGACTGGG + Intronic
1104623984 12:130338105-130338127 GAGGTGCAAGGACCAGGACTAGG + Exonic
1104720857 12:131044420-131044442 GGGCTGAGGGGACCGGTCCTGGG + Intronic
1105057326 12:133114197-133114219 GGGAAGAGAGGAGAAGGACTAGG + Exonic
1105274178 13:18905192-18905214 AGGCTTAGAGGACCAGGAGAAGG - Intergenic
1105299367 13:19118604-19118626 CGGCTTAGAGAACCAGGAATGGG + Intergenic
1106512931 13:30426612-30426634 AGGCTGTGTAGACCAGGACTAGG - Intergenic
1113600090 13:111562483-111562505 GGGCAGAGGGGACGAGGACCTGG - Intergenic
1113879281 13:113614622-113614644 GAGCTGGGAGGACCAGGACCAGG - Intronic
1114664471 14:24369678-24369700 AGGCTGGGAGGACCAGGAGGGGG + Exonic
1115750961 14:36489321-36489343 TGGCTGGGAGGAGCAGCACTGGG - Intronic
1117819244 14:59630883-59630905 GGGGTGAGAGGAGGAGGACTTGG + Intronic
1119806902 14:77487997-77488019 GGGCTGAGGGGATCAGGGCCGGG + Intronic
1122259386 14:100503684-100503706 GGGCTGAGGTGGCCAGGGCTGGG - Intronic
1123084195 14:105709957-105709979 GGGCTGAGCTGAGCTGGACTGGG - Intergenic
1123084621 14:105711679-105711701 GGGCTGGGATGAGCTGGACTGGG - Intergenic
1123109281 14:105858075-105858097 GGGCTGAGCTGAGCTGGACTGGG - Intergenic
1123109341 14:105858345-105858367 GGGCTGAGCTGAGCCGGACTGGG - Intergenic
1123109377 14:105858550-105858572 GGGCTGAGCTGACCTGGGCTGGG - Intergenic
1123109480 14:105859069-105859091 GGGCTGAGCTAACCAGGGCTGGG - Intergenic
1123109567 14:105859510-105859532 GGGCTGAGCTAACCAGGGCTGGG - Intergenic
1123109608 14:105859731-105859753 GGGCTGAGCTAACCTGGACTGGG - Intergenic
1123715348 15:23025425-23025447 ATGGTGAGAGCACCAGGACTTGG + Intronic
1126808560 15:52378158-52378180 TGGGTGAGAGGACCAGGAATAGG + Intronic
1126903192 15:53336012-53336034 GGGCAGAGAGGATCTGGAGTAGG + Intergenic
1128246204 15:66134481-66134503 TGGCTGAGAAGGCCAGGAGTGGG - Intronic
1129256697 15:74337867-74337889 GGGCAGAAAGGAGCAGGACTTGG + Exonic
1129264515 15:74386706-74386728 CGGCTGTGGGGACCAGGTCTGGG - Intergenic
1129694216 15:77731415-77731437 GGGCTGAGGGCACCAGGAGTGGG - Intronic
1129787744 15:78320658-78320680 GCACAGAGAGGAGCAGGACTTGG + Intergenic
1130783362 15:87069082-87069104 GGGGTGAGAGGACCAGGATTGGG + Intergenic
1131583489 15:93668527-93668549 TGGCAGTGAGGGCCAGGACTTGG + Intergenic
1132650120 16:1017202-1017224 GGGCTGAGGGAATCAGGAGTGGG - Intergenic
1132704573 16:1237533-1237555 GGGCAGAGAAGGCAAGGACTAGG + Intergenic
1132706940 16:1248892-1248914 GGGCAGAGAAGGCAAGGACTAGG - Intergenic
1134062314 16:11206511-11206533 GGGCGGACAGGACCAGGAAGTGG + Intergenic
1134095164 16:11414231-11414253 GGGTGGGGAGGACCAGGCCTTGG - Intronic
1135468657 16:22709531-22709553 AGTCTGAGAGGGCCAGAACTGGG - Intergenic
1136073859 16:27804990-27805012 GGGCTGTGAGGACTGGGATTGGG + Intronic
1136690370 16:32024268-32024290 GGGCTGAGAGGACCAGGTACAGG + Intergenic
1136790959 16:32967832-32967854 GGGCTGAGAGGACCAGGTACAGG + Intergenic
1136878854 16:33886100-33886122 GGGCTGAGAGGACCAGGTACAGG - Intergenic
1138410189 16:56833258-56833280 GCGCTGTCAGGAACAGGACTTGG - Exonic
1139494516 16:67306590-67306612 GGGGCTAGGGGACCAGGACTAGG - Intronic
1140126121 16:72120281-72120303 GGTCTGAGTGGACCAGGAGCTGG + Intronic
1140704748 16:77616881-77616903 GGGCTGACAGGGGCAGTACTGGG - Intergenic
1141252074 16:82368211-82368233 GGGCTGTGAGTGCCAGGTCTGGG + Intergenic
1142287971 16:89179160-89179182 GGGCTTTGAGGGCCAGTACTTGG + Intronic
1142361658 16:89630536-89630558 GTGCTTAGGGAACCAGGACTGGG + Intronic
1142395749 16:89830231-89830253 GGGCTGTGAGGACCAGGAAGGGG - Intronic
1203093166 16_KI270728v1_random:1229289-1229311 GGGCTGAGAGGACCAGGTACAGG + Intergenic
1143784775 17:9248058-9248080 GGGCTGAGAGGATGAGGAGCAGG - Intergenic
1144269334 17:13601688-13601710 TGGCTGAGAGAACCTGAACTCGG - Exonic
1144498556 17:15765701-15765723 GGGTTGAGGGGACCAGGAGGTGG + Intergenic
1144800502 17:17922914-17922936 GAGCAGAGAGGACCAGGACAAGG + Intronic
1144831281 17:18132594-18132616 GGGGTGGGAGGACCAGGGCCAGG - Intronic
1144834671 17:18150633-18150655 GGGCTGAGAGGACAGGGAGGAGG + Intronic
1145012541 17:19378110-19378132 GGCCTGAGATGCCCAGGTCTGGG - Intronic
1145161938 17:20580741-20580763 GGGTTGAGGGGACCAGGAGGTGG + Exonic
1146373510 17:32279933-32279955 GGGCTGAGCGCCCCAGGAATGGG + Intronic
1146655045 17:34630091-34630113 GGGCGGAGATGTCCAGGACGAGG - Exonic
1146744179 17:35313649-35313671 GGGCTGTGATGACGAGGAGTGGG + Intergenic
1147153227 17:38530403-38530425 GGGCTGAGAGGACCAGGTACAGG + Exonic
1147599959 17:41739384-41739406 GGGCTCAGTGGCCCAGGAGTTGG - Intergenic
1147673742 17:42191285-42191307 GTGCTCAGAGGATCAGGCCTGGG - Intronic
1147969349 17:44211242-44211264 GGGCAGAGAAGACTGGGACTTGG - Intronic
1148552848 17:48560812-48560834 GGGCTCAGAGGCCCAGGGTTGGG + Intronic
1148565973 17:48633306-48633328 GGACTGAGAGGCTAAGGACTGGG + Intronic
1148781324 17:50123685-50123707 GGGCTGGGAGGAGCAGGAAGAGG - Intronic
1148917688 17:50996455-50996477 CGGCTGAGATGAGCAGGGCTGGG + Intronic
1149852916 17:60051815-60051837 GGGCAGGGAGGACCCAGACTGGG - Intronic
1152098648 17:78288024-78288046 GCGGTGTGAGGACCAGGACGGGG - Intergenic
1152287656 17:79422073-79422095 GGGCTGAGAGAGGCGGGACTTGG + Intronic
1152328367 17:79655915-79655937 GGGCTGAGGTAAGCAGGACTAGG - Intergenic
1152410022 17:80118412-80118434 GGGGTGAGGGGACCTGGGCTTGG + Intergenic
1152436479 17:80279297-80279319 GGGCTTAGAGGGCCAGGCCCAGG + Intronic
1152841546 17:82571991-82572013 GTGCTGAGAGGAAGAGGAGTTGG + Intronic
1153043583 18:836158-836180 GGTTTGAAAGGACGAGGACTAGG + Intergenic
1154484980 18:14866218-14866240 CGGCTTAGAGGACCAGGAGAAGG + Intergenic
1157477785 18:48034499-48034521 GGGCTGGGAGGAAGAGGGCTGGG - Intronic
1159911840 18:74152797-74152819 GGGATGAGGGAAGCAGGACTGGG + Intronic
1159950319 18:74478239-74478261 GGGGTGTGAGGACCAGGCCCAGG - Intergenic
1160063377 18:75551893-75551915 GGGCTGAGGGTACCACCACTGGG + Intergenic
1160455209 18:78994681-78994703 GGCCTGCGAGGACGAGGACTCGG - Exonic
1160703403 19:518471-518493 GGGCTGAGAGGAGGAGGCCTGGG + Intronic
1160779733 19:872464-872486 GAGCTGAGAGGACCAGGGAAGGG + Intronic
1160825388 19:1077904-1077926 GCGCTGCGAGGACCACGACAAGG + Exonic
1161245554 19:3249720-3249742 GGTCTGAGAGGACCACAAGTTGG - Intronic
1161731592 19:5964170-5964192 GGGCTGCAAAGACCAGGACCAGG - Intronic
1162307767 19:9885765-9885787 GGGGTGAGGGGAGCAGGACCTGG - Intronic
1162462106 19:10819356-10819378 AGGCAGAGAGGAGCAGGGCTGGG - Intronic
1162926336 19:13932147-13932169 GAGCTGAGTGGCCCAGGCCTGGG - Intronic
1163427508 19:17247246-17247268 AGGTTGAGAGGCCCAGGGCTGGG - Intronic
1163466223 19:17469945-17469967 TGGCTGAGAGGGGCGGGACTCGG + Intronic
1164149874 19:22541667-22541689 GGCCTGCCAGGGCCAGGACTAGG + Intergenic
1164941495 19:32254926-32254948 TGGCTAAGAGGACCAGGAAAGGG + Intergenic
1165065662 19:33226599-33226621 GGGCTCAGCGGACTAGAACTCGG + Intergenic
1165433849 19:35786521-35786543 GGACTCAGAGGAGGAGGACTCGG - Intronic
1166067987 19:40371259-40371281 GGGCTGGGAGGACAGGCACTAGG - Intronic
1166754420 19:45181465-45181487 GCGCTGAAAGCACCAGGACTGGG - Exonic
1166857560 19:45790792-45790814 GGCCTGAGAGGGGCAGGACCAGG - Intronic
1166935712 19:46331168-46331190 GAGCTCAGAGGACGAGGACGAGG + Exonic
1167242218 19:48351183-48351205 AGGCTGAGAGGAGCAGGTTTGGG - Intronic
1167358213 19:49016758-49016780 GGGATGGGAAGGCCAGGACTCGG - Intronic
1167359712 19:49023647-49023669 GGGATGGGAAGGCCAGGACTCGG - Intronic
1167361419 19:49032438-49032460 GGGATGGGAAGGCCAGGACTCGG + Intronic
1167362232 19:49036347-49036369 GGGATGGGAAGGCCAGGACTGGG - Intronic
1167363849 19:49044511-49044533 GGGATGGGAAGGCCAGGACTCGG + Intronic
1167364649 19:49048416-49048438 GGGATGGGAAGGCCAGGACTCGG - Intronic
1167511174 19:49896051-49896073 GGGCTGGGAGGAGGAGGACAGGG + Exonic
1167674220 19:50874613-50874635 GGGGGCAGAGGACCAGGACTGGG - Intronic
1167676271 19:50887965-50887987 GGGGGCAGAGGACCAGGGCTGGG + Intergenic
1167781576 19:51601949-51601971 GAGAGGAGAGGACCAGGACTAGG + Intergenic
1168251832 19:55146294-55146316 GGGCTTAAAGGACCGGGCCTGGG + Intronic
925436830 2:3845818-3845840 GGGCTAAGAGAACCAGGCCCTGG + Intronic
925928015 2:8684656-8684678 GGGCTGAGTTGACAGGGACTGGG + Intergenic
926911133 2:17853086-17853108 TGGCTGAGGGGACCTGGAGTGGG - Intergenic
926911145 2:17853125-17853147 TGGCTGAGGGGACCTGGAGTGGG - Intergenic
926911187 2:17853281-17853303 TGGCTGAGGGGACCTGGAGTGGG - Intergenic
926911230 2:17853437-17853459 TGGCTGAGGGGACCTGGATTGGG - Intergenic
927891759 2:26755172-26755194 GGCTTGAGAGGAAGAGGACTGGG - Intergenic
927999071 2:27507311-27507333 GGTCGGAGAAGAACAGGACTTGG + Exonic
928196163 2:29218188-29218210 AGGCGGGGAGGACCATGACTGGG + Intronic
928325298 2:30314904-30314926 GGGCTGTGGGGACCAGGTCAAGG + Intronic
928436334 2:31257033-31257055 CTGCTGGGAGGACCAAGACTGGG - Intronic
928451498 2:31382351-31382373 GGGCTGGGAGGAATAGGAGTAGG + Intronic
929829970 2:45339299-45339321 GGGCTGAGAGGACAGGGATGGGG - Intergenic
929868047 2:45734985-45735007 GGGGTGATAGAAGCAGGACTGGG - Intronic
931379551 2:61739690-61739712 GGGCTGAGAGGAGGAGGAAGAGG + Intergenic
932196097 2:69785247-69785269 GGCCTGAGAGGTCCAGGCCAGGG + Intronic
932263916 2:70350338-70350360 GGGCTGGGAGTATGAGGACTGGG - Intergenic
933522499 2:83391149-83391171 AGGCTGAGAGGTCCAAGTCTAGG - Intergenic
933559961 2:83876583-83876605 GGGCTGAGCGGTCCAGGCTTTGG + Intergenic
933637049 2:84720025-84720047 GGTCTGAGAGGAGAAGGGCTAGG + Intronic
933727275 2:85434061-85434083 GGCCTGAGGGCATCAGGACTTGG - Intronic
934149681 2:89134494-89134516 GAGCTGACAGGACCATGAATGGG + Intergenic
934217616 2:90047534-90047556 GAGCTGACAGGACCATGAATGGG - Intergenic
936521920 2:113216805-113216827 GGGCTTAGAGTAAGAGGACTTGG + Exonic
937090784 2:119205009-119205031 GGCATGAGAGAACCAGGCCTTGG + Intergenic
938125010 2:128665031-128665053 GGCCTGAGAGACCCAGGACATGG - Intergenic
938262053 2:129903336-129903358 GGAGTGAGAGGCCCAGGATTCGG - Intergenic
938287470 2:130129676-130129698 CGGCTTAGAGGACCAGGAATGGG + Intergenic
938312156 2:130300505-130300527 TGGCTTGGAGGACCAGGAATGGG - Intergenic
938312179 2:130300636-130300658 TGGCTTAGAGGACCAGGAATGGG - Intergenic
938338533 2:130520248-130520270 GGGCTGCAAGGACCAGGTCAAGG - Intergenic
938351306 2:130600502-130600524 GGGCTGCAAGGACCAGGTCAAGG + Intergenic
938374702 2:130797860-130797882 AGGCTGGGAGGACCAGGCCCGGG + Intergenic
938405639 2:131031765-131031787 GGGCAGACAGGCCCAGGCCTGGG - Intronic
938428121 2:131209183-131209205 CGGCTTAGAGGACCAGGAATGGG - Intronic
938469027 2:131543182-131543204 CGGCTTAGAGGACCGGGAATGGG - Intergenic
938620122 2:133042991-133043013 GTCCTGAGAGGACCAAGACCTGG + Intronic
942298267 2:174537795-174537817 GGGAGGTGAGGAGCAGGACTGGG + Intergenic
942377886 2:175355781-175355803 AGTGTGAGAGGACCAGGCCTAGG + Intergenic
944222943 2:197320490-197320512 GGGATGAGGAGAGCAGGACTGGG - Intergenic
945418192 2:209600710-209600732 GGGCTGACAGAGCCAGGACACGG + Intronic
946138949 2:217671730-217671752 GGTCTGAGAAGTGCAGGACTTGG - Intronic
947872803 2:233449158-233449180 GGGCAGAGAGGACGAGGCCTGGG - Exonic
948790363 2:240373611-240373633 GTGCTGTGGGGACCAGGACATGG + Intergenic
948815883 2:240510175-240510197 GGGCAGGGAGGGCAAGGACTGGG - Intronic
949031391 2:241799017-241799039 GGGCTGGCACGACCCGGACTGGG + Intronic
1168834929 20:871657-871679 AGGCAGAGAGGATCTGGACTTGG + Exonic
1170474709 20:16703329-16703351 AGGCTATGAGGACCAGGACAGGG + Intergenic
1171381018 20:24734254-24734276 GAGCAGGGAGGACCAGGAGTGGG + Intergenic
1171391204 20:24802748-24802770 GGTCTTAGAGGACCAGGGCTGGG - Intergenic
1172027722 20:31960424-31960446 AGCCTGTGAGGTCCAGGACTGGG - Intergenic
1172387103 20:34541705-34541727 GGGCAGGGAGGACAAGGACGGGG - Intergenic
1174142322 20:48424535-48424557 GGTGAGAGATGACCAGGACTTGG - Intergenic
1174800630 20:53560451-53560473 GGGGTGAGAGAACCAGGAGAGGG + Intergenic
1175316984 20:58055288-58055310 GGGCTGAGAGCAGCTGGGCTGGG + Intergenic
1175824800 20:61931053-61931075 GGGCTGAGGTGCCCACGACTGGG - Intronic
1176077598 20:63255293-63255315 GGCCCGAGAGGAGCAGGACGTGG + Intronic
1176271836 20:64239434-64239456 GGGCTCAGAAAACCAGGAGTGGG + Intronic
1176723741 21:10413566-10413588 CGGCTTAGAGGACCAGGAGAAGG + Intergenic
1176796349 21:13373257-13373279 TGGCTTAGAGGACCAGGAGAAGG - Intergenic
1178719735 21:34997932-34997954 GGGGTGGAAGGACCAGGACTGGG + Intronic
1179276098 21:39893036-39893058 GGGCTGGGAGGATCAGCATTTGG + Intronic
1179323983 21:40321753-40321775 GCACAGAGAGGACCAGGCCTCGG - Intronic
1179960784 21:44766084-44766106 GGACTGAGAGGACCAGACCAGGG + Intergenic
1180080359 21:45483824-45483846 AGGCTGAGAGGACATGGGCTGGG + Intronic
1180115759 21:45703964-45703986 TGGGAGAGAGGACCAGGACATGG + Intronic
1180304895 22:11066347-11066369 CGGCTTAGAGGACCAGGAGAAGG + Intergenic
1180639754 22:17288845-17288867 GGGGTTACAGGACCAGGACAAGG + Intergenic
1180762909 22:18222877-18222899 GGGCCGAGAGGACGAAGCCTCGG + Intergenic
1181608961 22:23999932-23999954 GGGCTGCGGGAACCAGGCCTGGG - Intergenic
1181673687 22:24438215-24438237 GTGCTGACAGGTCCACGACTTGG + Intronic
1181764363 22:25080488-25080510 GTGCTGAGAGGAGCTGGCCTGGG - Intronic
1181853799 22:25768551-25768573 AAGCTGAGAAGACCCGGACTGGG + Exonic
1182368626 22:29795539-29795561 GGGGTGATAGGAAGAGGACTGGG - Intronic
1183381650 22:37493259-37493281 GGGCTGAGTGGTGCAGGGCTGGG - Intronic
1183690497 22:39385244-39385266 GGGCTGTGCGCACCAGGACATGG - Exonic
1183751762 22:39724982-39725004 GAGCTGAGGGGACAAGGAGTTGG - Intergenic
1184133003 22:42528976-42528998 GGCCTGAAAGCACCAGGACTAGG - Intergenic
1184807144 22:46802575-46802597 GGGCTGAGAAGTCCAGGAGAAGG + Intronic
1203234572 22_KI270731v1_random:142658-142680 GGGCCGAGAGGACGAAGCCTCGG - Intergenic
949930607 3:9075461-9075483 GGGCTGAGCAGATAAGGACTGGG + Intronic
950529264 3:13543686-13543708 GGGGTGTGTGGACAAGGACTGGG - Intergenic
950706487 3:14785683-14785705 GGGCTGAGAGGTCACGGACAAGG - Intergenic
951275439 3:20679482-20679504 GGTGTGAGAGTAACAGGACTCGG + Intergenic
953732829 3:45464818-45464840 GGGCTCTGAGGACCAGGCCAGGG + Intronic
954111009 3:48433035-48433057 GGGCTGAGAGGACCAAGAACTGG - Exonic
954404179 3:50336361-50336383 AGGCTCAGAGAACCAGGCCTAGG - Intronic
954611878 3:51948674-51948696 GGGCTGGGAGGAGAGGGACTGGG - Exonic
956141193 3:66148425-66148447 GGGCTGACAGGACCATGGCGAGG + Intronic
958959033 3:100491979-100492001 CTGCGGAGATGACCAGGACTGGG - Intergenic
960058669 3:113296509-113296531 GGAGTGAGAGCACCAGCACTAGG - Intronic
960249720 3:115438547-115438569 GGAATGAGAGAAGCAGGACTGGG - Intergenic
961550844 3:127669845-127669867 GTGGTGTGAGGAGCAGGACTGGG - Intronic
962264283 3:133934497-133934519 GGGCTGTGTGGGCCAGAACTGGG - Exonic
962698338 3:137972771-137972793 GGGCAGAGTGGACCAGGGCTGGG - Intergenic
963251270 3:143105434-143105456 CTGCTGAGATCACCAGGACTCGG + Intergenic
964595998 3:158429120-158429142 GGGCTGAAAGTACCAGCTCTGGG - Intronic
966201247 3:177361402-177361424 GGGGTGGGAGGGCCAGGCCTGGG - Intergenic
966502944 3:180666120-180666142 GGGCTGAGAGGAGCAGGGAATGG - Intronic
967089353 3:186122033-186122055 AAGCTCAGAGGAACAGGACTGGG + Intronic
967817084 3:193808741-193808763 GGGCTGAAAGGAGCATGCCTGGG - Intergenic
968039695 3:195578843-195578865 GGGCTGAGGGGAACAGGACCAGG - Intronic
969477242 4:7428620-7428642 GGACTGAGAGGAGCATGTCTAGG + Intronic
970932616 4:21530794-21530816 GTGCTGAGAAAGCCAGGACTTGG - Intronic
971502659 4:27333419-27333441 GGGCTGAGTGGATCAGTAATTGG + Intergenic
971519209 4:27528440-27528462 TGGCTGAGAGGTAAAGGACTTGG - Intergenic
982014997 4:151144791-151144813 GAGCTGAGTGGACCAGGAAGTGG - Intronic
982132706 4:152244824-152244846 GGGCAGAGAGGAGCAGGGTTGGG - Intergenic
984953758 4:185025475-185025497 GGGCTGAGTGGAGCATGCCTGGG - Intergenic
985747469 5:1655302-1655324 CGGCTGAGGGGACCAGGGCCTGG - Intergenic
986224578 5:5801033-5801055 TGGCTGACAGGGCCAGGACATGG - Intergenic
987793085 5:22593535-22593557 GAGATGAGAGGACCTGTACTAGG - Intronic
990155566 5:52873272-52873294 GGGCTGAGGGGAATAGGGCTAGG - Intronic
992500347 5:77336382-77336404 GGGCTGTGGGGAGGAGGACTAGG - Intronic
995744814 5:115392588-115392610 AGGCTGAGAGGACCTGAAATTGG - Intergenic
997173543 5:131750326-131750348 AGGCAGAGAGGACAAGGAATAGG + Intronic
997528198 5:134566876-134566898 AGGCTGAGAGCACCAGAGCTAGG + Intronic
997857820 5:137389253-137389275 GGACAGACAGGACCAGGACAAGG - Intronic
1000290192 5:159863035-159863057 GCGCTGAGAGCACCAGGATGAGG - Intergenic
1001312931 5:170624052-170624074 GAGCTGAGAGGACCAGGGGATGG - Intronic
1001548057 5:172582831-172582853 GAGGAGAGAGGACCAGGGCTGGG + Intergenic
1001579638 5:172789957-172789979 GGGGCGAGATGACCAGGGCTGGG - Intergenic
1001980928 5:176036669-176036691 CGGCTTAGAGGACCAGGACAAGG + Intergenic
1002236531 5:177807396-177807418 CGGCTTAGAGGACCAGGACAAGG - Intergenic
1002284469 5:178153162-178153184 GGGCTGAGAGGATTAGGGCGGGG + Intronic
1002381578 5:178833151-178833173 CAGCTTAGAGGACCAGGACCAGG + Intergenic
1002397999 5:178972755-178972777 GGGGTGAGAGAACCAGGAGCAGG + Intergenic
1003164687 6:3665890-3665912 GGGCTGGGAGCACCTGGCCTTGG + Intergenic
1003945389 6:11070819-11070841 GGGCTGAGATGACCTGAACTTGG + Intergenic
1006377292 6:33678555-33678577 GGGCTGGGAGCACCTGGACGAGG + Intronic
1006441822 6:34058033-34058055 AGTCTGAGAGGACCGGGGCTGGG + Intronic
1007768515 6:44176005-44176027 GGGCATGGAGGACCTGGACTGGG - Intronic
1008040657 6:46795128-46795150 GGACTGAGAGGAGCAGGTCTTGG - Intronic
1013457424 6:110343314-110343336 AGGATGAGGGGACCAGCACTGGG + Intronic
1014644151 6:123953520-123953542 GGGCTGGGTGGACCAGTCCTCGG + Intronic
1015966418 6:138698898-138698920 GGAGTGAGAGGATCAGGATTGGG - Intergenic
1016838650 6:148504642-148504664 GGGCTGAGAGCCACAGGGCTGGG + Intronic
1018998218 6:168726084-168726106 GGGCTGAGAGGAAGAGGAGGGGG + Intergenic
1019401308 7:855690-855712 GGGCTGAGAGGAGCAGGCAGAGG + Intronic
1019408708 7:897499-897521 GGGCTGAGGGGCCCAGCATTGGG + Intergenic
1019655634 7:2193373-2193395 GGGCTTTGAGGACCAAGAGTTGG - Intronic
1019699728 7:2468827-2468849 GGGCTGAGAGGAGGAGAACCAGG - Intergenic
1019947044 7:4338127-4338149 GGGCTGACAGCACCCGGACAGGG - Intergenic
1021517597 7:21504994-21505016 AAGATGAGAGGACCAGGACCGGG + Intronic
1022795912 7:33731224-33731246 GGGCAAACAGGCCCAGGACTAGG + Intergenic
1022981667 7:35610444-35610466 AGGCTGAGAGGGACAGGCCTGGG + Intergenic
1023204465 7:37733141-37733163 GGGCTGAGAAGATATGGACTTGG + Intronic
1023839538 7:44088601-44088623 GGCCTGCGGGGACCAGGACGTGG + Intergenic
1026589274 7:71681409-71681431 GGGCTGAGATGGCCAAGAGTTGG + Intronic
1029892642 7:103947055-103947077 TGGCTGAGAGGACTCGGAATGGG - Intronic
1031830719 7:126622128-126622150 TGTCTGACAAGACCAGGACTAGG + Intronic
1031979924 7:128117953-128117975 GGGCTGTGAGGACCAGAGCCAGG + Intergenic
1032433109 7:131879092-131879114 GTGCTCAGAAGACCTGGACTGGG + Intergenic
1032591153 7:133193643-133193665 GGGGAGAGAAGACCAGGAATTGG + Intergenic
1034192224 7:149221541-149221563 GGAGTGAGAGTAGCAGGACTGGG + Intronic
1034682608 7:152940523-152940545 GAGCTGGGAGGACCAGGCTTGGG + Intergenic
1036108513 8:5872067-5872089 GGGCTGGGAGGACCAGGGATTGG - Intergenic
1036189449 8:6656923-6656945 ACGCTGAGAGGAAGAGGACTAGG + Intergenic
1037733176 8:21546470-21546492 GAGCTGACAGGACCAGGAAGAGG - Intergenic
1038454790 8:27666159-27666181 GGGCTGAGAGAACAAAAACTGGG - Intronic
1040567907 8:48582964-48582986 GGGGTGTGAGGACCAGGAGAGGG + Intergenic
1042693781 8:71533108-71533130 GGGGTGAGAGGATGAGTACTGGG + Intronic
1049206251 8:141365024-141365046 AGGCTGAGAGGACCAGGCTGAGG - Intronic
1049444575 8:142624135-142624157 GGGCTGGCAGGACCAGGCCCAGG - Intergenic
1049621343 8:143599610-143599632 GGGCGGAGAGGACGAGGAGGAGG + Exonic
1053008421 9:34619901-34619923 GGTCTGAAAGGACCAGGATTAGG - Intronic
1053311844 9:37025433-37025455 GGGGTGGGAGGACCAGGCATGGG + Intronic
1053658314 9:40243481-40243503 GGCCTCAAATGACCAGGACTAGG - Intronic
1053885894 9:42645071-42645093 CGGCTTAGAGGACCAGGAGAAGG + Intergenic
1054224912 9:62452520-62452542 CGGCTTAGAGGACCAGGAGAAGG + Intergenic
1054370438 9:64389756-64389778 GGCCTCAAATGACCAGGACTAGG - Intronic
1054526284 9:66132740-66132762 GGCCTCAAATGACCAGGACTAGG + Intronic
1054678065 9:67879511-67879533 GGCCTCAAATGACCAGGACTAGG - Intronic
1055313581 9:75010522-75010544 GGGCTGGGAGGAGAAGGAGTGGG + Intronic
1057227923 9:93302225-93302247 GCGCTGAGAGGCTGAGGACTTGG + Intronic
1058865483 9:109158490-109158512 GGGCTGAGAGGAGGGGGAATTGG - Intronic
1059987672 9:119835905-119835927 GGGCAGAGAGGCCCCAGACTGGG - Intergenic
1060105948 9:120873700-120873722 GTGCTGGGAGGGCCAGGACTGGG - Intronic
1060192896 9:121604152-121604174 GGGCTGAGAGGGCCTGCAGTGGG - Intronic
1060503453 9:124180621-124180643 GGACTCAGAGGACCAGGAAGAGG - Intergenic
1060700894 9:125747902-125747924 GGGCTGCGAGGGGCAGGACGGGG - Intronic
1060759200 9:126234191-126234213 GGGCTGGCAGGAGGAGGACTTGG + Intergenic
1060973781 9:127753559-127753581 GGGCAGAGAGGCCCAGGGCTGGG + Intronic
1061226994 9:129286148-129286170 GGGCTGAGAGGACATGGGCTGGG + Intergenic
1061288640 9:129638534-129638556 CGGGTGAGAGGACGAGGCCTAGG + Intronic
1061413021 9:130431225-130431247 GGGCTGGGAGGGGCAGGACAGGG + Intronic
1061866478 9:133494077-133494099 GGGCAGAGGGGCACAGGACTCGG + Intergenic
1061877158 9:133549980-133550002 GGGCACACAGCACCAGGACTAGG + Intronic
1062020162 9:134315640-134315662 GGGCTGCGAGGCCCAGCACACGG + Intergenic
1062220851 9:135414395-135414417 GGGCTGTGGGGGCCAGGAGTGGG + Intergenic
1062366317 9:136211117-136211139 GTGCTGACGGGATCAGGACTTGG - Intronic
1062564709 9:137159046-137159068 GGGTGTGGAGGACCAGGACTGGG - Intronic
1062628384 9:137453121-137453143 GGCCTTCGAGGACCTGGACTGGG - Exonic
1186220090 X:7341401-7341423 CAGCTGAGAGGACGAGGACCAGG - Intronic
1186809996 X:13178999-13179021 GAGCTGAGACGAGCAGGATTTGG - Intergenic
1187464236 X:19514558-19514580 GGGATGAGAGGAAGGGGACTAGG + Intronic
1189629342 X:42934781-42934803 GGGCTGAGGGGACCACAGCTGGG + Intergenic
1190304365 X:49073726-49073748 GGTCTTTGAGGACCAGGACGGGG - Intronic
1190316665 X:49156239-49156261 GGGTTCAGAGGAGCAGGCCTGGG - Intergenic
1191882679 X:65858264-65858286 GTGCTGAGAGGAAGAGAACTGGG + Intergenic
1191911639 X:66157833-66157855 GTGCTTAGAGGAATAGGACTGGG + Intergenic
1195065658 X:101236085-101236107 AGGCTGAGAGGAGAAGGACAGGG - Intronic
1196532608 X:116806527-116806549 GGGCTGAGAGTAAGTGGACTAGG - Intergenic
1197014984 X:121613624-121613646 AGGCTGAGAAGTCCAAGACTGGG - Intergenic
1198621867 X:138521431-138521453 GGGCAGAGTGGATCAGGATTGGG - Intergenic
1199036426 X:143056042-143056064 AGGCTGGGAGGCCCAAGACTGGG - Intergenic
1199500282 X:148500348-148500370 GGGCTGGCGGGACCAGGACGCGG - Intergenic
1200070612 X:153527239-153527261 GGGCTGGGAGGACAGGGACCCGG + Intronic
1200142203 X:153907850-153907872 GGGCTTCGGGGCCCAGGACTGGG + Exonic
1200167074 X:154043895-154043917 GGGCTGAGAGGAGTGGGAGTGGG - Intronic