ID: 906128349

View in Genome Browser
Species Human (GRCh38)
Location 1:43441390-43441412
Sequence TGGTGGTGGTGTGCCCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 615
Summary {0: 1, 1: 0, 2: 3, 3: 66, 4: 545}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906128341_906128349 18 Left 906128341 1:43441349-43441371 CCAGGCTCAGATTCTGGAGCCCA 0: 1
1: 0
2: 0
3: 21
4: 247
Right 906128349 1:43441390-43441412 TGGTGGTGGTGTGCCCTGGGAGG 0: 1
1: 0
2: 3
3: 66
4: 545
906128342_906128349 -1 Left 906128342 1:43441368-43441390 CCCAGAGACAAAAGTATGTGTGT 0: 1
1: 0
2: 2
3: 23
4: 322
Right 906128349 1:43441390-43441412 TGGTGGTGGTGTGCCCTGGGAGG 0: 1
1: 0
2: 3
3: 66
4: 545
906128343_906128349 -2 Left 906128343 1:43441369-43441391 CCAGAGACAAAAGTATGTGTGTG 0: 1
1: 0
2: 3
3: 41
4: 320
Right 906128349 1:43441390-43441412 TGGTGGTGGTGTGCCCTGGGAGG 0: 1
1: 0
2: 3
3: 66
4: 545

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906128349 Original CRISPR TGGTGGTGGTGTGCCCTGGG AGG Intronic
900363006 1:2298975-2298997 TGGTGCCTGTGAGCCCTGGGTGG + Intronic
900461549 1:2804451-2804473 TGGTGCTGGTGGGGCCTCGGCGG - Intergenic
900968208 1:5974271-5974293 TGGGGCTGGTGCGCTCTGGGAGG + Intronic
901126692 1:6934435-6934457 TGGTGAATGGGTGCCCTGGGAGG + Intronic
901206113 1:7496824-7496846 AGGTGGTGTTGGGGCCTGGGAGG - Intronic
901448882 1:9324320-9324342 TGTTGGTGGTGTGCCATCTGCGG + Intronic
902091878 1:13910092-13910114 TGTTGGAAGTGTGGCCTGGGGGG + Intergenic
902306317 1:15542395-15542417 GGAGGGTGGTGAGCCCTGGGAGG + Intronic
902382808 1:16060521-16060543 TGCTGGAGGTGAGACCTGGGTGG + Intronic
902991020 1:20186884-20186906 TGGTGGGGGTGTGGGTTGGGGGG + Intronic
904616084 1:31750708-31750730 TGGGGATGGGGTGCCATGGGGGG - Intronic
906128349 1:43441390-43441412 TGGTGGTGGTGTGCCCTGGGAGG + Intronic
906615116 1:47228715-47228737 TGGTGGTGCTGTTCCCTGGTGGG - Intronic
907770058 1:57452600-57452622 TGGTGGTGGGGGGCGCGGGGTGG + Intronic
908583247 1:65540342-65540364 TGTTGGTGGTGGGGCCTGGTGGG + Intronic
908786176 1:67736640-67736662 TGGCAGAGGTGTGCCCTGTGAGG - Intronic
910329720 1:86057062-86057084 TGTTGGAGGTGTGGCCTGGTGGG + Intronic
910843816 1:91586483-91586505 TGTTGGTGGTGTGCTTAGGGAGG - Intergenic
912566614 1:110592151-110592173 TGGTTGGGGTGAGCCCAGGGTGG + Intergenic
912687236 1:111777156-111777178 AGGTGGTAGTGAGGCCTGGGTGG + Exonic
912759405 1:112353818-112353840 TAGTGGTGGAGTGCCTAGGGAGG - Intergenic
913053972 1:115140596-115140618 TAGGGGTGTTCTGCCCTGGGTGG + Intergenic
913093359 1:115494806-115494828 TGATGCTGGAGAGCCCTGGGGGG - Intergenic
915087362 1:153397717-153397739 TGGTGGGGGTGGGCCCTGAGGGG - Intergenic
915739655 1:158109092-158109114 TGTTGGAGGTGTGACCTGGTGGG - Intergenic
916466929 1:165082086-165082108 TGTTGGAGGTGTGGCCTGGTAGG - Intergenic
916497251 1:165356752-165356774 AGGGGGTGGGGTGCGCTGGGCGG + Intergenic
917516466 1:175712579-175712601 TGCTGGTGGTGGGGCCTGGTGGG + Intronic
917972807 1:180219559-180219581 TGGAGAAGGGGTGCCCTGGGTGG - Intergenic
918178895 1:182069209-182069231 TGTAGGTGGTGTGACCTGGGAGG - Intergenic
918473901 1:184903431-184903453 TGTTGGAGGTGTGGCCTGGTGGG + Intronic
919576077 1:199311321-199311343 TGGTGGTGGTGGGGGCGGGGTGG - Intergenic
919803315 1:201366366-201366388 TGAAGGTGGTGTGTGCTGGGGGG - Intronic
919900360 1:202039716-202039738 AGAGGGTGGTGTGCCCAGGGAGG + Intergenic
920445111 1:206010425-206010447 TGGTGGTGGCTGGCACTGGGTGG + Intronic
920920119 1:210291959-210291981 TGGTGGTGGTGGGGAGTGGGGGG + Intergenic
921301395 1:213754433-213754455 TGTTGGAGGTGGGGCCTGGGGGG + Intergenic
921443260 1:215214385-215214407 TGTTGGTGGTGGGACCTGGTGGG - Intronic
922221287 1:223610436-223610458 TGCTGGTGGTGTGGCCAGAGAGG + Intronic
922629510 1:227091296-227091318 TGTTGGAGGTGGGGCCTGGGGGG + Intronic
922904034 1:229160216-229160238 TGTTGGAGGTGGGCCCTGGTGGG + Intergenic
924331748 1:242946646-242946668 TGGTGGTGGTGTGAGCATGGGGG - Intergenic
1062831782 10:610700-610722 TGTTGGAGGTGGGCCCTGGTGGG + Intronic
1062831802 10:610761-610783 TGTTGGAGGTGGGCCCTGGTGGG + Intronic
1062831820 10:610822-610844 TGTTGGAGGTGGGCCCTGGTGGG + Intronic
1062831840 10:610883-610905 TGTTGGAGGTGGGCCCTGGTGGG + Intronic
1062831861 10:610944-610966 TGTTGGAGGTGGGCCCTGGTGGG + Intronic
1062831880 10:611005-611027 TGTTGGAGGTGGGCCCTGGTGGG + Intronic
1062831896 10:611065-611087 TGTTGGAGGTGGGCCCTGGTGGG + Intronic
1062886621 10:1021264-1021286 TGGTGGGGCTGTGGGCTGGGTGG + Intronic
1063002379 10:1936399-1936421 TGCTGGAGTTCTGCCCTGGGGGG - Intergenic
1063557178 10:7091982-7092004 TGTTGGAGGTGGGGCCTGGGGGG - Intergenic
1065674786 10:28163127-28163149 TGGAGGTGCTGTGTGCTGGGTGG - Intronic
1066015159 10:31233627-31233649 TGGCGGCAGTGTGCCCTGGATGG - Intergenic
1066250120 10:33625049-33625071 TGTTGGAGGTGGGCCCTGGTGGG - Intergenic
1066384204 10:34928452-34928474 TGGTGGTGGGGTGCTCTCTGAGG - Intergenic
1067355161 10:45517368-45517390 TGTTGGAGGTGTGACCTGGTGGG + Intronic
1068991652 10:63157143-63157165 TGGAGCTGGTGTGCCCTGAGAGG + Intergenic
1069301340 10:66912213-66912235 TGGTGGTGGTGTGGTGTGTGAGG - Intronic
1070459295 10:76648722-76648744 TGTTGGTGGTGGGGCCTGGTGGG + Intergenic
1070466298 10:76727077-76727099 TGTTGGTGGTGGGGCCTGGTGGG + Intergenic
1070557154 10:77537413-77537435 TGGGGAAGGTGGGCCCTGGGTGG - Intronic
1070867915 10:79719235-79719257 TGGAGGTGGGGCGCACTGGGAGG - Intergenic
1071592749 10:86891162-86891184 TGGTGGTGGTGGGCTCTGCGTGG + Intronic
1071634827 10:87241436-87241458 TGGAGGTGGGGCGCACTGGGAGG - Intergenic
1071921945 10:90360319-90360341 TGTTGGTGGTGGGGCCTGGTGGG - Intergenic
1071933179 10:90496740-90496762 TCGTGGTGCAATGCCCTGGGTGG + Intergenic
1073345954 10:102783103-102783125 TGGTTCTGGAGTGCCGTGGGAGG + Intronic
1073434812 10:103510020-103510042 TGGAGGTCTTGTACCCTGGGAGG + Intronic
1073552622 10:104417181-104417203 TGGTGCTGGTGGGCCCAGGATGG + Intronic
1073589551 10:104743526-104743548 TGGGGGAGATGTGCCTTGGGAGG + Intronic
1074217400 10:111399138-111399160 TGGTGGTGGTGGGGCCTGGTGGG + Intergenic
1074290210 10:112132632-112132654 TGGTGGAGGTGGGGCCTGGTGGG + Intergenic
1075016661 10:118914663-118914685 TGCTGGAGGTGGGGCCTGGGGGG - Intergenic
1075261182 10:120964992-120965014 TGGTGGTGGCCTGCTCTGTGAGG - Intergenic
1075404325 10:122184308-122184330 GGGTGGGGGGGTGCCCTGGTGGG + Intronic
1075586769 10:123664333-123664355 TGTTGGAGGTGGGCCCTGGTGGG + Intergenic
1076191344 10:128485641-128485663 TGGTGGAGGTGGGCCCTGTGGGG - Intergenic
1076419753 10:130322641-130322663 TGTTGGAGGTGTGGCCTGGTGGG - Intergenic
1076441785 10:130485435-130485457 TGGGGGTGGTGTGCCCTTTAGGG - Intergenic
1076948532 10:133666844-133666866 TGGTGGTGGTGTGGGGTGGGGGG - Intergenic
1076951490 10:133676752-133676774 TGGTGGTGGTGTGGGGTGGGGGG - Intergenic
1076952480 10:133680062-133680084 TGGTGGTGGTGTGGGGTGGGGGG - Intergenic
1076955436 10:133743023-133743045 TGGTGGTGGTGTGGGGTGGGGGG - Intergenic
1076956426 10:133746333-133746355 TGGTGGTGGTGTGGGGTGGGGGG - Intergenic
1076957414 10:133749642-133749664 TGGTGGTGGTGTGGGGTGGGGGG - Intergenic
1076959387 10:133756251-133756273 TGGTGGTGGTGTGGGGTGGGGGG - Intergenic
1077187823 11:1243354-1243376 CGGTGGTGGTCAGCACTGGGGGG - Exonic
1077188206 11:1244854-1244876 TGGTGGTGGTCAGCACTGTGGGG - Exonic
1077188245 11:1245025-1245047 CGGTGGTGGTCAGCACTGGGGGG - Exonic
1077188778 11:1247125-1247147 CGGTGGTGGTCAGCACTGGGGGG - Exonic
1077189161 11:1248625-1248647 TGGTGGTGGTCAGCACTGTGGGG - Exonic
1077189199 11:1248796-1248818 CGGTGGTGGTCAGCACTGGGGGG - Exonic
1077898684 11:6473466-6473488 TGGTGGTGGTGCGTGCTGAGTGG - Intronic
1078406492 11:11074554-11074576 TGGTGGTGGTGGACATTGGGCGG + Intergenic
1078461984 11:11521134-11521156 AGGAGGTGGTGGGCCTTGGGTGG - Intronic
1078669728 11:13354191-13354213 TGGTGGTGGGGGGCCGGGGGGGG - Intronic
1078936335 11:15954124-15954146 TGTTGGAGGTGGGGCCTGGGAGG - Intergenic
1079673968 11:23202335-23202357 GGGTGCTGGTGTGACCTGGCTGG + Intergenic
1080306585 11:30843662-30843684 TGTTGGTGGTGGGGCCTGGTGGG - Intronic
1080882181 11:36332608-36332630 TGGTGGAGGTGGGGCCTGGTGGG + Intronic
1081369107 11:42276824-42276846 TGTTGGAGGTGAGCCCTGGTGGG - Intergenic
1081602633 11:44505863-44505885 TGGTGGAGGTGTGGCGTGGTGGG + Intergenic
1081675716 11:44967870-44967892 GGGTGGAGATGGGCCCTGGGAGG + Intergenic
1081813517 11:45926370-45926392 TGGTGGTGGGGGGCCATGGATGG + Intronic
1081925976 11:46828853-46828875 GGGTGGGGGTGTGGCTTGGGAGG + Intronic
1082808424 11:57464129-57464151 TGGGGGAGGTGAGCCCTGGTTGG + Intronic
1083586520 11:63863758-63863780 TGGTGGTGGTGTGGGGCGGGGGG - Intronic
1083662982 11:64260411-64260433 TGCTGGTGATGTGGCCTGGGAGG + Intronic
1083687944 11:64388579-64388601 TGGTGCAGAGGTGCCCTGGGAGG + Intergenic
1084665602 11:70574586-70574608 TGGGGGTGGCGTGCCCTGAAGGG + Intronic
1086008462 11:82068980-82069002 GTGTGCTGGTGTGCACTGGGAGG + Intergenic
1086611155 11:88757592-88757614 TGGTGGTGGTGTTAGCAGGGGGG - Intronic
1087718223 11:101632950-101632972 TGGTAGTGTTGGGCCCTGAGTGG - Intronic
1088188820 11:107204833-107204855 TGTTGGAGGTGTGGCCTGGTGGG - Intergenic
1089144028 11:116311303-116311325 TGGAGGGGGTGTGGCCTGGGGGG - Intergenic
1090189944 11:124760953-124760975 TGGCCTTGGTGTGGCCTGGGGGG + Intronic
1090668303 11:128929760-128929782 TGGTGGTGCTGGGCACAGGGCGG - Intergenic
1091589693 12:1835923-1835945 TGGTGGTGCTTTGCCATTGGTGG + Exonic
1091857709 12:3752867-3752889 TGGAGGCTGTGTGCCCTTGGGGG - Intronic
1092345465 12:7711040-7711062 TGGTGGTGGTGGGGCGGGGGCGG + Intergenic
1092602513 12:10082333-10082355 TGGTGTTGGTGGGGCATGGGGGG + Intronic
1093703172 12:22245924-22245946 GGGGGGTGGTGTGCCCAGGGAGG + Intronic
1094144060 12:27210574-27210596 TGTTGGTGGTGGGGCCTGGTGGG + Intergenic
1094443753 12:30507607-30507629 GGAGGGTGGTGTGCACTGGGAGG - Intergenic
1095311706 12:40706007-40706029 TGTTGGAGGTGTGGCCTGGTGGG - Intronic
1095825839 12:46530490-46530512 AGGTGGAGGTGGGCCCGGGGCGG + Intergenic
1095900492 12:47323172-47323194 TGCTGGAGGTGTGGCCTGGTGGG + Intergenic
1096465460 12:51845997-51846019 GGGTGGTGGAGACCCCTGGGTGG - Intergenic
1096605355 12:52761053-52761075 TGCTGGTTTTGTGGCCTGGGGGG - Intergenic
1096789668 12:54036963-54036985 TGGGGCTGGTGTGCCCTGCCTGG - Intronic
1097021060 12:56021123-56021145 TGGTGGGTGTGTGCACAGGGAGG - Intronic
1097928297 12:65156043-65156065 TGTTGGAGGTGTGGCCTGGTGGG - Intergenic
1098547559 12:71728310-71728332 TGTTGGGGGTGGGGCCTGGGGGG - Intergenic
1098547583 12:71728370-71728392 TGTTGGAGGTGGGGCCTGGGGGG - Intergenic
1098957966 12:76707048-76707070 TGGTGTTGGTGGGGCCAGGGGGG + Intergenic
1098977628 12:76919829-76919851 TGGTGGTGGTGAGCCCTTTGTGG + Intergenic
1100142621 12:91636790-91636812 TGTTGGAGGTGTGGCCTGGTGGG + Intergenic
1100208411 12:92376196-92376218 TGCTGGTGGTGGGGCCTGGTGGG + Intergenic
1100393372 12:94163564-94163586 TGCTGGTGGGTTGGCCTGGGTGG + Intronic
1101285725 12:103310094-103310116 TGTTGGAGGTGGGCCCTGGTGGG + Intronic
1101372456 12:104141710-104141732 TGTTGGAGGTGTGGCCTGGTGGG + Intergenic
1102031211 12:109741167-109741189 GGGTGGTGGGGTGTCCTAGGAGG - Intronic
1102120065 12:110433271-110433293 TGGTGGTGGTGTGTCGTGGGGGG - Intergenic
1102392590 12:112561591-112561613 TGTTGGTGGAGTGACCTGGTGGG + Intergenic
1102915917 12:116751962-116751984 TGGTGTTGCTGTGCCCTGGCGGG + Intronic
1103847435 12:123911307-123911329 TGGGGGGGGTCTGTCCTGGGGGG + Intronic
1103847449 12:123911337-123911359 TGGGGGGGGTCTGTCCTGGGGGG + Intronic
1103847555 12:123911578-123911600 TGGGGGGGGTCTGTCCTGGGGGG + Intronic
1103847578 12:123911625-123911647 TGGGGGGGGTCTGTCCTGGGGGG + Intronic
1103847592 12:123911655-123911677 TGGGGGGGGTCTGTCCTGGGGGG + Intronic
1103847615 12:123911702-123911724 TGGGGGGGGTCTGTCCTGGGGGG + Intronic
1103847717 12:123911929-123911951 TGGGGGGGGTCTGTCCTGGGGGG + Intronic
1103847818 12:123912141-123912163 TGGGGGGGGTCTGTCCTGGGGGG + Intronic
1103847826 12:123912157-123912179 TGGGGGGGGTCTGTCCTGGGGGG + Intronic
1103847838 12:123912187-123912209 TGGGGGGGGTCTGTCCTGGGTGG + Intronic
1103847884 12:123912294-123912316 TGGGGGGGGTCTGTCCTGGGGGG + Intronic
1104070388 12:125339662-125339684 TGTTGGTGGTGTGTCCTGAGAGG + Intronic
1104099169 12:125589940-125589962 TGGTGGAGGTGGGGCCTGGTGGG + Intronic
1104120380 12:125793256-125793278 TGCTGGAGGTGTGTCCTGGTGGG - Intergenic
1104521723 12:129481858-129481880 TGGTGGTGGGGGTGCCTGGGAGG - Intronic
1104692679 12:130838876-130838898 TGCTGGTGGGGTCCCCAGGGCGG - Intronic
1104848203 12:131857754-131857776 TGGTGGTGGTGGGTGCTGTGAGG + Intergenic
1105211458 13:18259451-18259473 GGGTGGGACTGTGCCCTGGGAGG + Intergenic
1105608581 13:21947693-21947715 GGGTGGTGCTGGGCACTGGGTGG + Intergenic
1105787399 13:23762883-23762905 TGGTAGAGCTGTGCCCTAGGTGG + Intronic
1108259591 13:48643659-48643681 TGGTGGTGGAGTGCACAGCGGGG - Intergenic
1108818736 13:54320460-54320482 TGTTGGAGGTGTGGCCTGGTAGG + Intergenic
1109856238 13:68131506-68131528 TGTTGGTGGTGGGGCCTGGTAGG - Intergenic
1111464807 13:88594892-88594914 AGGTGGTGTTGTGACCTGGCTGG - Intergenic
1111803165 13:93005249-93005271 TGTTGGAGGTGGGCCCTGGTGGG - Intergenic
1112505238 13:99971132-99971154 TGGTGGTGGTGTAGCCCGAGAGG + Exonic
1113808966 13:113126128-113126150 TGAAGGTGGTGAGGCCTGGGAGG + Intronic
1114383578 14:22233678-22233700 TGGTGGAGGTGGGGCCTGGGGGG - Intergenic
1114621738 14:24100125-24100147 TGATGGTGGCGTGTACTGGGAGG + Exonic
1116369945 14:44117619-44117641 TGCTGGTGGTGGGTCCTGGTGGG - Intergenic
1116715130 14:48417255-48417277 TGGTGGAGGTGGGGCCTGGTGGG + Intergenic
1117353965 14:54905891-54905913 GGAGGGTGGTGTGCCCAGGGAGG + Intergenic
1118087209 14:62431561-62431583 AGGTTGTGGTGAGACCTGGGAGG + Intergenic
1118096666 14:62545344-62545366 TAGTGGTGGTGAGCCCAAGGAGG + Intergenic
1118188540 14:63559515-63559537 TGCTGGAGGTGGGGCCTGGGAGG - Intergenic
1118716652 14:68564644-68564666 TGGTGGTGGGGAGCCCTGTGAGG - Intronic
1118857503 14:69635581-69635603 TGTGTGTGGTGTGCCTTGGGTGG - Intronic
1118896079 14:69946782-69946804 TGTTGGAGGTGGGCCCTGGTGGG + Intronic
1119586560 14:75841146-75841168 TGCTGGTGGTGGGGCCTGGTGGG - Intronic
1119621857 14:76137412-76137434 GGGTGGTGGAGTGGGCTGGGAGG - Intergenic
1119642949 14:76328554-76328576 AGGTGGGTGTGAGCCCTGGGAGG - Intronic
1119887142 14:78152589-78152611 TGGTGTTGGTGTGGGCAGGGAGG + Intergenic
1121053790 14:90836822-90836844 GGGTGGAGGGGTGCCCTGTGAGG + Intergenic
1121053806 14:90836867-90836889 GGGTGGAGGGGTGCCCTGTGAGG + Intergenic
1121529661 14:94643623-94643645 AGGTGGTGGTGTTCCCAGCGTGG - Intergenic
1121586984 14:95069204-95069226 TGGTGGTGGAGGGACATGGGGGG + Intergenic
1122630177 14:103104088-103104110 TGGAGGGGGCGGGCCCTGGGGGG + Intronic
1122641648 14:103163564-103163586 GGGTGGGGGTGGGCCATGGGTGG - Intergenic
1122835589 14:104429330-104429352 CAGTGGTGAGGTGCCCTGGGCGG + Intergenic
1202852350 14_GL000225v1_random:29798-29820 GGGTGGTGGTGTGGGGTGGGAGG - Intergenic
1123687974 15:22813138-22813160 AGGTGGTGGGGTGGGCTGGGGGG + Intronic
1123932730 15:25179606-25179628 TGGGGGTGGTGTGACCTTAGTGG + Intergenic
1124267544 15:28250307-28250329 TGGTGGTGGTGAGCCCAGTGAGG - Intronic
1124653276 15:31488135-31488157 AGGTGGTGATGAGCCCTGGAAGG + Intronic
1124946124 15:34268396-34268418 TGGTAGTGTTGTGCAATGGGAGG + Intronic
1124963206 15:34413523-34413545 TGCTGGTGGTGGGGCCTGGTGGG - Intronic
1124979828 15:34559749-34559771 TGCTGGTGGTGGGGCCTGGTGGG - Intronic
1128578871 15:68795067-68795089 TGGTGGTGGTGTGTGCTGCAGGG - Intronic
1129503516 15:76061456-76061478 TGGAGGTGGGGAGCCCTGAGGGG + Intronic
1129821139 15:78602747-78602769 TGGGGGTGGACTCCCCTGGGTGG - Intronic
1129996986 15:80015461-80015483 TGTTGGAGGTGGGGCCTGGGAGG - Intergenic
1130042263 15:80414877-80414899 TGGTGGTGGTGTGGTGGGGGTGG + Intronic
1130552957 15:84903670-84903692 TGGTAGTGTTGAGTCCTGGGTGG + Intronic
1131257880 15:90873483-90873505 TGGTGGTGGTGGGGGCAGGGGGG + Intronic
1131969745 15:97879959-97879981 TGTTGGAGGTGGGCCCTGGTGGG - Intergenic
1132773775 16:1580342-1580364 TGTTGGAGGTGGGGCCTGGGGGG + Intronic
1132847558 16:2007397-2007419 TGCAGGTGGGCTGCCCTGGGGGG + Intronic
1134196081 16:12160140-12160162 TGATGCTGGTGAGGCCTGGGTGG + Intronic
1134251434 16:12577017-12577039 TGGTGGTGGTGAGGCGTGGAGGG - Intergenic
1135607612 16:23836987-23837009 CGGCGGTGGTGTCCTCTGGGAGG - Intronic
1136184002 16:28574408-28574430 TTCTGGTGATGTGCCCTGGGAGG + Intronic
1136538342 16:30913599-30913621 GGGTGGTGGTGGGCTCTGGTGGG - Intergenic
1136986109 16:35106644-35106666 TAATGGGGGTGTGCCCTGTGGGG + Intergenic
1137887320 16:52119054-52119076 TGGTGGTAGTCTTCCCTGGGTGG - Intergenic
1138853284 16:60656332-60656354 TGGAGGTGGTGTCCAGTGGGAGG - Intergenic
1139000643 16:62506107-62506129 TGGGGGTCATGTGCCCTGGGAGG + Intergenic
1139360240 16:66393594-66393616 TGTTGGAGGTGGGCCCTGGTGGG - Intronic
1139371735 16:66473324-66473346 TGGTGGTGGTGACCCCTGTGGGG + Intronic
1139935952 16:70571291-70571313 TGGCTGTGGTCTGCCCTGAGGGG - Intronic
1140052858 16:71498152-71498174 TGGTGGAGGTGGGGCCTGGTGGG + Intronic
1140313737 16:73873074-73873096 TGGTGGTGGTGGGTGGTGGGTGG + Intergenic
1140313806 16:73873265-73873287 TGGTGGTGGTGGGTGGTGGGTGG + Intergenic
1141110575 16:81267836-81267858 TGATGGTGGTGTGGTCTTGGGGG + Intronic
1141581816 16:85004536-85004558 TGGTGGTGGGGTGGAGTGGGGGG - Intronic
1141946538 16:87314584-87314606 TGGTGGTGGTGGGTTCAGGGGGG + Intronic
1141969664 16:87472475-87472497 TGCTGGTGGTCTGCTCTGTGGGG - Intronic
1142029168 16:87829863-87829885 GGGTGGGGGTGAGCCATGGGCGG - Intergenic
1142470654 17:161594-161616 TGGTGGAGGTGTGCGCAGGTAGG + Intronic
1142803202 17:2357933-2357955 TTGTGGTGGTGCACCCAGGGTGG + Intronic
1143012243 17:3872421-3872443 TGGCGGTGCTGTTCCCTGGGAGG - Intronic
1143731877 17:8886141-8886163 TGGAGGTGGGGTTACCTGGGAGG - Intronic
1143873501 17:9974833-9974855 GGGTGGGGGTGAGCCCTGGGTGG - Intronic
1144385398 17:14744761-14744783 TTGTGGTGGTGTGCTCACGGGGG - Intergenic
1144438963 17:15264632-15264654 TGGTGTGGCTGTGACCTGGGTGG - Intronic
1145165708 17:20612187-20612209 TGGTGGAGGTGGGGCCTGGTGGG - Intergenic
1145818752 17:27814898-27814920 TGTTGGAGGTGGGCCCTGGTGGG - Intronic
1146651566 17:34610008-34610030 TGGGTGTGGTGGGACCTGGGTGG - Intronic
1146935282 17:36809132-36809154 GGGAGGGGGTGTGTCCTGGGAGG - Intergenic
1146965744 17:37028310-37028332 TGGTGGTGGTCGGGGCTGGGAGG + Intronic
1147133761 17:38423731-38423753 TGGTGGGGGTGTTGCCTGTGGGG + Intergenic
1147968190 17:44205541-44205563 TGGGGGTGGGGAGGCCTGGGGGG - Exonic
1148765768 17:50037448-50037470 ATGTGGCTGTGTGCCCTGGGAGG + Intergenic
1149015271 17:51901591-51901613 TGGTGGTGGTGTGGCAGGGATGG + Intronic
1149581986 17:57757061-57757083 TGGAGGTGGTGTGTCTCGGGAGG - Intergenic
1150123952 17:62624817-62624839 TGTTGGAGGTGGGCCCTGGTGGG - Intergenic
1150486021 17:65544372-65544394 TGGTGGTGGTGGGGGATGGGGGG - Intronic
1152563763 17:81091155-81091177 TGGGGGTGGGGTGCACTGGAGGG - Intronic
1152999776 18:443769-443791 TGGTGGAGGTGGGGCCTGGTAGG + Intronic
1153380037 18:4428162-4428184 TGTTGGTGGTGGGGCCTGGTGGG + Intronic
1153752610 18:8248698-8248720 GGGGGGTGGGGTGCCCTGAGTGG - Intronic
1153757604 18:8299924-8299946 TGGTAGAAATGTGCCCTGGGGGG - Intronic
1153778381 18:8473627-8473649 TGTTGGAGGTGGGGCCTGGGGGG - Intergenic
1155249636 18:23942354-23942376 TGGTGCAGGGGTGCCCTGAGAGG - Intronic
1155593238 18:27452544-27452566 TACTGGTGGTGTTCTCTGGGAGG + Intergenic
1155679235 18:28469381-28469403 TGGTGGTGGTGTGTGTGGGGAGG - Intergenic
1156670130 18:39458823-39458845 TGTTGGGGGTGGGGCCTGGGAGG + Intergenic
1157282263 18:46353855-46353877 TTGTGGTGGGGTGGCCTGGCTGG + Intronic
1160090130 18:75819092-75819114 TGGTGGTTGTGTGCACTATGGGG - Intergenic
1160219912 18:76967401-76967423 TGGAGGTGGTGTGATCTGTGAGG + Intronic
1160219934 18:76967598-76967620 TGGAGGTGGTGTGATCTGTGAGG + Intronic
1160219947 18:76967715-76967737 AGGTGGTGGTGTGCTCTGTGAGG + Intronic
1160785903 19:900218-900240 TGGGCGTGGTCTTCCCTGGGTGG - Intronic
1160797875 19:954114-954136 GGGTGCTGGGGGGCCCTGGGAGG + Intronic
1161061515 19:2217473-2217495 TGATGGATGTGGGCCCTGGGAGG + Intronic
1161399988 19:4063002-4063024 GGGTGGGGGTGAGCCTTGGGTGG - Intronic
1162934787 19:13976505-13976527 TGGTAGTGCTGTACCCAGGGAGG + Intronic
1163007544 19:14406168-14406190 TGTTGGGGGTGGGCCCTGGGGGG + Intronic
1164578104 19:29417843-29417865 TGTTAGTGGTGTCCCCGGGGAGG + Intergenic
1164622185 19:29703042-29703064 TGATGGTGGTGTGCACTCAGTGG - Intronic
1164683720 19:30153026-30153048 TGGCTGTGGTCTGCCCTAGGTGG + Intergenic
1164861990 19:31568884-31568906 TGTTGATGGGGTGCCCTGGCTGG + Intergenic
1165500514 19:36185552-36185574 TGGTGGTTTTGTACACTGGGAGG - Intronic
1165711146 19:38011859-38011881 TGGTGGTGGCTTGGCCTGGGAGG + Intronic
1166122267 19:40692893-40692915 TGTTGGTGGGGTGCAGTGGGGGG - Intronic
1166439726 19:42802528-42802550 GGGTGGTGGTGTGACCTGCCTGG + Intronic
1166457768 19:42958067-42958089 GGGTGGTGGTGTGACCTGCCTGG + Intronic
1166468247 19:43054057-43054079 GGGTGGTGGTGTGACCTGCCTGG + Intronic
1166474709 19:43113286-43113308 GGGTGGTGGTGTGACCTGCCTGG + Intronic
1166488691 19:43238378-43238400 GGGTGGTGGTGTGACCTGCCTGG + Intronic
1166812223 19:45521405-45521427 AGGTGGGGCTGGGCCCTGGGTGG + Exonic
1167006134 19:46777626-46777648 TGGTGTGGGTGGGCTCTGGGTGG - Intronic
1167160442 19:47764098-47764120 TCGTGGTGGTGGGTGCTGGGTGG + Intergenic
1167609820 19:50501699-50501721 TGAGGCTGGTGGGCCCTGGGAGG - Intergenic
1167623948 19:50574558-50574580 TGTTGGAGGTGGGGCCTGGGGGG + Intergenic
1168713296 19:58513702-58513724 GGGTGGTGGTGGGGGCTGGGGGG - Exonic
925160240 2:1678308-1678330 TGGTGATGGGGAGCCATGGGAGG - Intronic
925163313 2:1701795-1701817 TGGCGGTGGTGCCCCCAGGGTGG + Intronic
925900539 2:8506135-8506157 TGTTGGAGGTGGGGCCTGGGGGG + Intergenic
926014128 2:9434245-9434267 TGGTGGTGCAGTTACCTGGGAGG + Intronic
927142452 2:20139733-20139755 TGGGGGTGGAGGGCTCTGGGAGG - Intergenic
927211695 2:20642700-20642722 TGATGGACGTGGGCCCTGGGTGG - Intronic
929530298 2:42746793-42746815 GGAGGGTGGTGTGCCCAGGGAGG - Intronic
929673752 2:43903552-43903574 TTGTGGTGATGTGCTCAGGGAGG + Intronic
929883965 2:45862325-45862347 TGGAGGTGGTGAGACCTGGACGG - Intronic
930490221 2:52059371-52059393 TGGTGGAGGTGGGGCCTGGAAGG + Intergenic
930906490 2:56574606-56574628 TGGTGGAGGTGGGGCCTGGTGGG + Intergenic
931219464 2:60276293-60276315 TGCTGCTGCTGAGCCCTGGGTGG - Intergenic
931246812 2:60498945-60498967 TGGTGGTGGTGGGTGGTGGGGGG + Intronic
931430546 2:62205756-62205778 TAGTGGCTGTGTGCCGTGGGCGG + Intronic
932098773 2:68877255-68877277 TGGTGGCAGAGTGCCCTGGCTGG - Intergenic
932110347 2:68993540-68993562 TGGTCCTGGTTTGGCCTGGGTGG - Intergenic
932187956 2:69714671-69714693 TTGTGATGGGATGCCCTGGGAGG + Intronic
934558031 2:95297632-95297654 TGGTGTTGGAGTGTCCTGGCTGG + Intronic
934558043 2:95297672-95297694 TGGTGTTGGGGTGTCCTGGCTGG + Intronic
934615719 2:95769431-95769453 TGGTGGTGCTGGGCTCTGGGAGG + Intergenic
934645178 2:96055126-96055148 TGGTGGTGCTGGGCTCTGGGAGG - Intergenic
934791638 2:97067356-97067378 TGTTGGAGGTGGGCCCTGGTGGG + Intergenic
934791824 2:97068527-97068549 TGTTGGAGGTGGGCCCTGGTGGG + Intergenic
934814792 2:97315183-97315205 TGTTGGAGGTGGGCCCTGGTGGG - Intergenic
934822902 2:97393300-97393322 TGTTGGAGGTGGGCCCTGGTGGG + Intergenic
934838582 2:97611215-97611237 TGGTGGTGCTGGGCTCTGGGAGG - Intergenic
934991433 2:98924670-98924692 TGGGGGTGCCATGCCCTGGGGGG - Intronic
935218476 2:100992439-100992461 TGTTGGAGGTGTGGCCTGGTGGG + Intronic
935800699 2:106692384-106692406 TGGTGGTGCAGGGACCTGGGTGG - Intergenic
936061312 2:109297431-109297453 TGGAGGAGGTATGCCCAGGGTGG - Intronic
936279863 2:111128998-111129020 TGGAAGTGATGTGCCCTGAGTGG - Intronic
937868737 2:126772681-126772703 TGGTGGAGGTGGGGCCTGGTGGG - Intergenic
938099234 2:128486814-128486836 TGTTGGTGCAGTGCTCTGGGAGG - Intergenic
938114736 2:128595395-128595417 GGGTGGTGGTGTGCACTCGGCGG + Intergenic
939019283 2:136939872-136939894 TGGTGGTGGTGTGTGTCGGGGGG - Intronic
939448286 2:142337720-142337742 TGCTGGAGGTGGGCCCTGGTGGG + Intergenic
939864830 2:147461043-147461065 TGGTGGTGGTGTGGGCAGTGAGG - Intergenic
939938078 2:148316167-148316189 TGTTGGAGGAGTGCCCTGGTAGG - Intronic
942265867 2:174225040-174225062 TGGTGGAGGTGGGGCCTGGTGGG + Intronic
942549069 2:177095549-177095571 TGTTGGAGGTGGGCCCTGGTTGG - Intergenic
942659151 2:178245916-178245938 TGATGTTTGTGTGCCCTGGATGG + Intronic
944099614 2:196009158-196009180 TGTTGGAGGTGTGGCCTGGTGGG - Intronic
944939992 2:204613975-204613997 TGGTGGTGGTTTTCCCTGTGAGG + Intronic
945125696 2:206507262-206507284 TGGTGGAGGTGGGGCCTGGTGGG + Intronic
946924379 2:224612168-224612190 TTGTGGAAATGTGCCCTGGGGGG + Intergenic
947592775 2:231395052-231395074 TGGTGGTGGGGAGCCCTCAGAGG + Intergenic
947839286 2:233197458-233197480 TGGTGGGGGGGTAGCCTGGGTGG - Intronic
947866730 2:233402998-233403020 TGGTGGTGGTTAGCCTTGGGAGG + Intronic
948317211 2:237037386-237037408 TAGTGGTGGTGTCCCCTGCTGGG + Intergenic
1168818025 20:754307-754329 TGGAAGTGGTGTGCCCTGAGAGG + Intergenic
1169019327 20:2317252-2317274 TGGGTGTGGTGTGCCTTGGCTGG + Intronic
1169245016 20:4018274-4018296 TGGAGGTGATGTTCCCTGGTGGG + Intergenic
1169699643 20:8432031-8432053 TGGTGGGGGTGGGAGCTGGGAGG + Intronic
1170291542 20:14775602-14775624 TGTTGATGGTGTGACCTGGTGGG - Intronic
1170331090 20:15211448-15211470 TGTTGGAGGTGTGGCCTGGTGGG + Intronic
1170449476 20:16467298-16467320 AGGTGGTGGTGAGGCGTGGGGGG - Intronic
1170456540 20:16538770-16538792 TGCTGGTGGTGTGGCCTGGTGGG + Intronic
1170964179 20:21051979-21052001 TGGAGGTGGTGATCTCTGGGAGG + Intergenic
1170989325 20:21287535-21287557 TGGTGGTGGTGTGGGCGGGGGGG + Intergenic
1172580635 20:36044528-36044550 TGCTGATGGTGTAACCTGGGTGG - Intergenic
1172699760 20:36845835-36845857 TGGGGGTGGGGGGCCCTGGGAGG + Intronic
1174350736 20:49965852-49965874 GGGTGGGGTTGGGCCCTGGGAGG - Intergenic
1175046866 20:56115021-56115043 TGTTGGTGGTGGGGCCTGGTGGG - Intergenic
1175767446 20:61601324-61601346 TGTTGGAGGTGGGGCCTGGGGGG - Intronic
1175827129 20:61942386-61942408 TGCTGGTTCTGTGTCCTGGGAGG - Intergenic
1175894450 20:62329902-62329924 TGGCGTTGGCGTGGCCTGGGCGG + Exonic
1175939229 20:62530292-62530314 TGGTGGTGGGGTGGGGTGGGAGG + Intergenic
1175971314 20:62687993-62688015 TGGTGGTGCTGGGACCTGGAAGG - Intergenic
1176386282 21:6139945-6139967 TGGTGGGGAGGTGACCTGGGGGG + Intergenic
1178029425 21:28507038-28507060 TGCTGGAGGTGTGGCCTGGTTGG - Intergenic
1178465318 21:32842484-32842506 TGTTGGAGGTGTGGCCTGGTGGG + Intergenic
1179642763 21:42758057-42758079 GGCTGGAGGTGGGCCCTGGGTGG + Intronic
1179737191 21:43398307-43398329 TGGTGGGGAGGTGACCTGGGGGG - Intergenic
1180044399 21:45297473-45297495 TGTTGGAGGTGTGGCCTGGTGGG + Intergenic
1180764770 22:18339987-18340009 GGGTGGGACTGTGCCCTGGGAGG - Intergenic
1180814259 22:18779697-18779719 GGGTGGGACTGTGCCCTGGGAGG + Intergenic
1180877269 22:19180428-19180450 TGCTGCTGGTGTGTGCTGGGAGG - Intronic
1181008359 22:20025514-20025536 TGGTGGTGGTGTGATATGGACGG - Intronic
1181200445 22:21214032-21214054 GGGTGGGACTGTGCCCTGGGAGG + Intronic
1181475391 22:23164889-23164911 TGGGGGTGGGGTGGGCTGGGTGG - Intergenic
1181633340 22:24162878-24162900 TGGTGTCTATGTGCCCTGGGAGG + Intronic
1181701293 22:24622927-24622949 GGGTGGGACTGTGCCCTGGGAGG - Intronic
1181772802 22:25139020-25139042 TGGGGGTGGTGTGCAGTGGCTGG - Intronic
1181828619 22:25540434-25540456 TGGTGGTGGTGAGTGGTGGGTGG + Intergenic
1182000377 22:26914936-26914958 TGGTGGAGGTGTGCCGAGGGTGG + Intergenic
1182301195 22:29338049-29338071 TCTTGGGGGTGTGCCCTAGGTGG + Intronic
1183653513 22:39172116-39172138 TGGTGGAGGAGTGCTCAGGGAGG - Intergenic
1183781501 22:40001992-40002014 TGGTGGTGGTGGGCCGTGGTTGG + Intronic
1183786536 22:40032170-40032192 TGGTGGTGGTGTGGGGTGGGAGG - Exonic
1184176986 22:42794162-42794184 TGGTGGGGGTGTGGTCAGGGTGG + Intergenic
1184674964 22:46036509-46036531 TAGTCGGGGTCTGCCCTGGGTGG + Intergenic
1184706973 22:46221278-46221300 TGGTGGAGGTGAGGCCTGGCGGG - Intronic
1203226393 22_KI270731v1_random:80892-80914 GGGTGGGACTGTGCCCTGGGAGG - Intergenic
1203264358 22_KI270734v1_random:5384-5406 GGGTGGGACTGTGCCCTGGGAGG + Intergenic
949855093 3:8453936-8453958 TGGTGGTGGTGTGCTGGGGCTGG - Intergenic
950556244 3:13697734-13697756 TGGTGGAGATCTTCCCTGGGTGG + Intergenic
951689141 3:25376937-25376959 TGGTGTTAGTGGGACCTGGGTGG + Intronic
952794048 3:37223346-37223368 TTGGGCTGGTGTGCCCTGAGGGG - Intergenic
953769893 3:45771890-45771912 TGGAGGGGGTGTGGCCTGGCAGG + Intronic
953788094 3:45925925-45925947 TTGTGTTGTTGTGTCCTGGGAGG - Intronic
953997837 3:47534480-47534502 TGGGGCTGGTGTCACCTGGGTGG - Intergenic
954420628 3:50417309-50417331 TGGTTGGGATGTGCCCTGTGTGG - Intronic
955141252 3:56272211-56272233 TGGTTTTGGTGTGCCCAGGTTGG - Intronic
956052024 3:65258098-65258120 TGCTGGAGGTGGGGCCTGGGGGG - Intergenic
956560130 3:70565819-70565841 TGGAGGTGGTGCACCCAGGGAGG - Intergenic
957680297 3:83425170-83425192 TGCTGGTTGTGGGGCCTGGGGGG - Intergenic
958454191 3:94309205-94309227 GGAAGGTGGTGTGCCCAGGGAGG + Intergenic
959650346 3:108745002-108745024 TGGTGATGATGTGCCCTGCATGG + Intronic
960885898 3:122394236-122394258 TGTTGGAGGTGTGGCCTGGTGGG - Intronic
961185494 3:124911611-124911633 TGGTGGGGGTGGGGCATGGGAGG + Intronic
962268013 3:133957245-133957267 AGGTGGTGGTGGGCTCTGGTGGG - Intronic
962335553 3:134527260-134527282 TGGTGGTGGTGTTGGCTTGGGGG + Intronic
963803170 3:149697541-149697563 TGTTGGTGGTGGGACCTGGTGGG - Intronic
964327738 3:155565341-155565363 TGTTGGAGGTGGGCCCTGGTGGG + Intronic
964790649 3:160450809-160450831 TGGAGCTGGTGTCTCCTGGGTGG - Intronic
965487756 3:169299320-169299342 TGGCGTGGGTGTGCACTGGGTGG - Intronic
966272167 3:178120592-178120614 TGTTGGAGGTGTGGCCTGGTGGG + Intergenic
966511335 3:180766545-180766567 TTGTTGTGGTCTGCCCTGGGTGG - Intronic
967158898 3:186718063-186718085 TGGTGGTGGTGGGTGGTGGGTGG - Intronic
967158981 3:186718296-186718318 TGGTGGTGGTGGGTGGTGGGTGG - Intronic
967158994 3:186718329-186718351 TGGTGGTGGTGGGTGGTGGGTGG - Intronic
967303326 3:188038023-188038045 TGGTGGTGCTGTGGCCAGTGTGG - Intergenic
967473449 3:189889433-189889455 AGGTGGGGGTGTGCAGTGGGAGG - Exonic
968129332 3:196183558-196183580 TCGTGGCGGTGTGTGCTGGGCGG + Intergenic
968289209 3:197525806-197525828 GGGAGGTGGTGTGGCCTGCGGGG - Intronic
968589824 4:1451820-1451842 TCGTGATGGGATGCCCTGGGAGG - Intergenic
968754688 4:2409229-2409251 TGGTGGGGGTGGGACCTGGCTGG - Intronic
968820003 4:2843488-2843510 TGCTGGGGGAGTGCGCTGGGCGG + Intergenic
969314372 4:6372650-6372672 TGGTGGAGGTGAGCCCTCGGAGG - Exonic
969442304 4:7224658-7224680 TGTTGGCGGTGGGGCCTGGGGGG - Intronic
969533073 4:7740291-7740313 TGGTGGTTCTGTGCCCTCCGTGG - Exonic
969573264 4:8022509-8022531 TGGTGTTAGAGGGCCCTGGGGGG - Intronic
970044841 4:11840445-11840467 TGTTGGAGGTGGGCCCTGGTGGG + Intergenic
970801157 4:19975294-19975316 TGTTGGAGGTGGGCCCTGGGGGG + Intergenic
971452972 4:26817447-26817469 TGGTAGTTGCGTGCCCTTGGAGG + Intergenic
971848215 4:31947207-31947229 TGTTGGAGGTGTGGCCTGGTGGG + Intergenic
972390816 4:38611177-38611199 AGATGGTGGTGTGCCAGGGGTGG + Intergenic
974386078 4:61202490-61202512 TGCTGGTAGTGGGCACTGGGCGG + Intronic
975357371 4:73424016-73424038 TGGAGATGGTGGGCCCTGGCTGG + Intergenic
975412456 4:74069885-74069907 AAGTGGTTGTCTGCCCTGGGTGG + Intergenic
977378174 4:96236172-96236194 TGTTGGTGGTGGGGCCTGGTGGG + Intergenic
977537506 4:98272051-98272073 TGGTGGTGCTGTTCCCAGTGTGG - Intronic
977553599 4:98467276-98467298 GGAGGGTGGTGTTCCCTGGGAGG + Intergenic
978740805 4:112135949-112135971 TGTTGGAGGTGGGGCCTGGGGGG + Intergenic
979765001 4:124453785-124453807 TGTTGGAGGTGGGGCCTGGGGGG - Intergenic
979990194 4:127366546-127366568 GGAGGGTGGTGTGCCCAGGGAGG - Intergenic
981825471 4:148935771-148935793 TGTTGGTGGTGGGGCCTGGTGGG + Intergenic
982727268 4:158918898-158918920 TGGTGGTGGTGTTCATTGTGGGG - Intronic
982776997 4:159452364-159452386 TGGTGGTGGTGTCGTTTGGGGGG + Intergenic
982989907 4:162259903-162259925 TGGTGATGGTGTGCGGTGGGGGG - Intergenic
983075057 4:163316255-163316277 TGTTGGAGGTGGGGCCTGGGAGG - Intergenic
983585324 4:169348258-169348280 TGTTGGAGGTGGGCCCTGGTGGG - Intergenic
984213413 4:176878318-176878340 TGTTGGTGGTGGGGCCTGGTGGG + Intergenic
985484492 5:140821-140843 TTGTGGTGGTGTGCAGGGGGAGG - Intronic
985666060 5:1181995-1182017 AGGTCGGGGTGTGGCCTGGGAGG - Intergenic
985723360 5:1502262-1502284 GGCTGGGGGTGTGTCCTGGGGGG - Intronic
985724973 5:1511335-1511357 TGCAGGTGGTGTCCCCTGAGGGG - Intronic
986065092 5:4227642-4227664 TGTTGGTGGTGGGGCCTGGCTGG - Intergenic
987858998 5:23459451-23459473 TGTTGGAGGTGGGGCCTGGGAGG - Intergenic
987964407 5:24853172-24853194 TGTTGGTGGTGGGGCCTGGTAGG + Intergenic
988717900 5:33846012-33846034 TGCTGGAGGTGGGCCCTGGTGGG - Intronic
989381115 5:40810393-40810415 GGGGGGTGGTGTGCCTTGAGAGG - Intergenic
990269041 5:54114988-54115010 TGCAGTTGGTGTGCCCTGGCTGG + Intronic
990504885 5:56434255-56434277 TGCTGGTGGTGGGGCCTGGAGGG - Intergenic
990735137 5:58852247-58852269 TGGTGGTGGTGTGCATTATGGGG - Exonic
991938431 5:71827220-71827242 TGGTGGTGGTGTGGCTTTGTTGG + Intergenic
992001553 5:72441360-72441382 TGCTGGCAGTGTGGCCTGGGAGG - Intergenic
992376312 5:76191255-76191277 TGTTGGAGGTGGGACCTGGGAGG - Intronic
992595294 5:78340547-78340569 TGGTGGTAGTGGGCCCTGACCGG + Intergenic
993449817 5:88059738-88059760 TACTGGTTGTGTACCCTGGGTGG + Intergenic
993501524 5:88672621-88672643 TGGTGGTGGTGTGTTTGGGGGGG - Intergenic
994380738 5:99067979-99068001 TGTTGGAGGTGTGGCCTGGTGGG - Intergenic
994935688 5:106250564-106250586 TGGTGGTAGATTGTCCTGGGAGG + Intergenic
995313393 5:110739071-110739093 CGGTGGTGGTGGGCTCCGGGCGG + Exonic
997182798 5:131849134-131849156 TGTTGGAGGTGGGCCCTGGTGGG + Intronic
997642787 5:135460428-135460450 TGGTGGGGGTGAGCCATGTGAGG - Intergenic
999381378 5:151123846-151123868 TGGTGGGAGTGTGCCCTGCTGGG - Intronic
999422543 5:151457453-151457475 TGAGAGTGGTGTCCCCTGGGTGG - Intronic
999740217 5:154544196-154544218 TGGCTGAGGGGTGCCCTGGGTGG + Intergenic
999900482 5:156081319-156081341 TGTTGGAGGTGGGCCCTGGTGGG - Intronic
999900816 5:156085283-156085305 TGCTGGAGGTGTGGCCTGGTGGG + Intronic
1000889035 5:166782360-166782382 TGGTGGGGGGGAGTCCTGGGGGG - Intergenic
1001061441 5:168493132-168493154 TGGTGGTGATGAGTGCTGGGAGG + Intronic
1001258179 5:170201253-170201275 GGGTGCTGGTGTGCCCAGAGTGG - Intergenic
1001561192 5:172670010-172670032 TGGTGGCCGTGCGCCCTGGCTGG + Exonic
1002428185 5:179187960-179187982 AGGGGATGGTGAGCCCTGGGAGG + Intronic
1002586685 5:180253087-180253109 TGTGGGAGGTGTGCCCTGGCAGG - Intronic
1002781888 6:373258-373280 TGGTGGATGTGTGCCCGGCGAGG + Intergenic
1003046499 6:2737957-2737979 TGGGGGTGGGGTGCCGGGGGCGG + Intronic
1004496281 6:16166140-16166162 GGAAGGTGGTGTGCCCAGGGAGG - Intergenic
1004918703 6:20356356-20356378 TGCTGGAGGTGTGGCCTGGTAGG + Intergenic
1005806067 6:29475521-29475543 TGGCAGAGGTGTGCTCTGGGCGG + Intergenic
1006374106 6:33662450-33662472 AGGTGGGGCTGGGCCCTGGGTGG + Intronic
1006724486 6:36187522-36187544 TGTTGGAGGTGGGGCCTGGGTGG - Intergenic
1006830124 6:36963506-36963528 TGGAGGAGGTGTGCCCCGTGTGG - Exonic
1007095870 6:39212661-39212683 TGGTGGGGGTGTGGTCTGGGAGG - Intronic
1007212053 6:40201305-40201327 TGTTGGAGGTGGGCCCTGGCGGG + Intergenic
1007340411 6:41187818-41187840 GGGAGGTGGGGTGTCCTGGGAGG + Intergenic
1009514396 6:64596196-64596218 TGCTGGAGATGTGGCCTGGGGGG - Intronic
1010630036 6:78188578-78188600 TGTTGGAGGTGTGGCCTGGTGGG - Intergenic
1011749014 6:90436593-90436615 TGTTGGAGGTGGGGCCTGGGGGG + Intergenic
1013970483 6:116012193-116012215 TGGTGGTGGTGTGAGCAAGGGGG - Intronic
1014771295 6:125460145-125460167 TGCTGGAGGTGGGCCCTGGTGGG - Intergenic
1015603179 6:134930193-134930215 TGGTGGTGTTGTTCCCTGGAAGG + Intronic
1016041646 6:139437934-139437956 TGGAGGAGCTGTGGCCTGGGTGG - Intergenic
1016828744 6:148412741-148412763 TGGTGGAGGTGGGGCCTGGTCGG - Intronic
1016849435 6:148601840-148601862 TAGTGGTTTTCTGCCCTGGGTGG - Intergenic
1017419285 6:154257175-154257197 TGCTAGTTGTGGGCCCTGGGAGG - Intronic
1017760333 6:157563230-157563252 TGGCCGTGGTGTTTCCTGGGAGG - Intronic
1017937891 6:159023118-159023140 TGTTGGTGGTGTGGCCGGGGAGG + Intergenic
1017987434 6:159456087-159456109 TGGTGGTGGTGCTCCCCGGGTGG - Intergenic
1017987442 6:159456107-159456129 TGGTGATGGTGCTCCCCGGGTGG - Intergenic
1017987449 6:159456127-159456149 GGGTGGTGGTGCTCCCCGGGTGG - Intergenic
1018420338 6:163635252-163635274 TGGTGGCGGAGTGTTCTGGGGGG + Intergenic
1019155725 6:170037679-170037701 TGCTGGTTCTGGGCCCTGGGAGG - Intergenic
1019428807 7:989127-989149 AGGTGCTGGGGGGCCCTGGGGGG - Exonic
1019532475 7:1510785-1510807 TGGTGCTGGTGGGTCTTGGGGGG - Intergenic
1020247810 7:6443691-6443713 TGGTGGTGAGGTGCACTGGGAGG - Intronic
1021645140 7:22782370-22782392 TGGTGGAGGTGGGCCAGGGGAGG - Intergenic
1023075288 7:36475628-36475650 CCGTGGTGGTGTGTCCTGTGTGG + Intergenic
1023391180 7:39713254-39713276 TGCTGGAGGTGGGCCCTGGTGGG + Intergenic
1023706170 7:42943817-42943839 TGGTGGTGGTGGGGCCTGGTGGG + Intronic
1023842583 7:44105385-44105407 AGGTGGTGGTGAGCAATGGGTGG + Intronic
1024385597 7:48748358-48748380 TGGTGGTGGTATGACTTGGGTGG + Intergenic
1024493988 7:50021772-50021794 GGGTGGTGGTGTGCCCAAAGTGG + Intronic
1024839642 7:53570834-53570856 TGTTGGAGGTGGGCCCTGGCAGG + Intergenic
1025636394 7:63323608-63323630 TGTTGGTGGTGGAGCCTGGGGGG + Intergenic
1025646302 7:63424494-63424516 TGTTGGTGGTGGAGCCTGGGGGG - Intergenic
1025939976 7:66068808-66068830 TGTTGGAGGTGGGCCCTGGTGGG - Intergenic
1028478974 7:91283611-91283633 TGTTAGTGGTTTGCCCAGGGGGG - Intergenic
1029171243 7:98630460-98630482 TGGTGGTGGTGGGCGGTGGGGGG - Intergenic
1030064498 7:105648929-105648951 TGCAGGTGGTGAGACCTGGGAGG + Intronic
1032093797 7:128927369-128927391 TGGTGGTGGTGGGTGGTGGGGGG + Intergenic
1032159580 7:129500450-129500472 TGGTCGAGGTGTGCCATGGGTGG - Intergenic
1033368757 7:140690635-140690657 TGGTGTATGTGTGCCCTGGCGGG + Intronic
1033638551 7:143237702-143237724 TGGTAGTGGTGGGCACTGGGTGG + Intergenic
1033830450 7:145245276-145245298 TGCTGGAGGTGTGGCCTGGTAGG - Intergenic
1034202247 7:149289930-149289952 TGGTGGTGGCCTGGCCTGTGGGG - Intronic
1035176586 7:157056313-157056335 TGGTGGCGGTGTCCCCTGGGAGG - Intergenic
1035564979 8:635392-635414 TAGTGGTGATGAGCCCTGCGGGG - Intronic
1036927706 8:12923251-12923273 TGTTGGTGGTGGGGCCTGGTGGG - Intergenic
1037801950 8:22040738-22040760 TGGTGGAGGTGTCAGCTGGGGGG - Intergenic
1037815626 8:22110182-22110204 TGCAGATGGTGCGCCCTGGGAGG + Intergenic
1038104412 8:24416388-24416410 TGTTGGAGGTGTGGCCTGGTGGG + Intergenic
1038225551 8:25654056-25654078 TGGTGGTGGATTGAGCTGGGTGG + Intergenic
1038289572 8:26236923-26236945 TGTTGGTGGAGTGCGGTGGGGGG - Intergenic
1039402974 8:37287293-37287315 TGGTGGAGGTGGGGCCTGGTGGG + Intergenic
1040843288 8:51807428-51807450 TGGAGGTGGGGTGCAGTGGGAGG - Intronic
1042034357 8:64515195-64515217 TGAAGGTGGTGTGACCTGAGGGG - Intergenic
1042042590 8:64608669-64608691 TGGAGGTGGTGTGCTCTGGAAGG + Intronic
1042396332 8:68295371-68295393 TGTTGGTGCTGTTCCATGGGGGG + Intergenic
1042947772 8:74172191-74172213 TAGAGTTGGTGTGTCCTGGGTGG - Intergenic
1044079202 8:87863130-87863152 TGTTGGTGGTGGGGCCTGGTAGG + Intergenic
1046134025 8:110003673-110003695 TGTTGGAGGTGGGCCCTGGTGGG - Intergenic
1046237622 8:111447337-111447359 TGTTGGAGGTGGGCCCTGGTGGG - Intergenic
1046342706 8:112879587-112879609 TGCTGGTTTTGTGGCCTGGGGGG + Intronic
1046540001 8:115567677-115567699 TGGTGTTGGTGTGACCTGATGGG - Intronic
1047697224 8:127415917-127415939 TGGGGGTGATGGGCCATGGGGGG + Exonic
1047813260 8:128433803-128433825 TGTTGGAGGTGTGCCATGGTGGG + Intergenic
1048448472 8:134510831-134510853 AGGAGGTTGTGAGCCCTGGGAGG - Intronic
1048865878 8:138761143-138761165 TGCTGGTGGTGTGGGCTGGCCGG - Intronic
1049001475 8:139828046-139828068 TGTTGGTGGTGGGGCCTGGTGGG - Intronic
1049172724 8:141171927-141171949 TGGTGGTGGTGTGCAGTGTCTGG + Intronic
1049190086 8:141282490-141282512 TGGAGGCGGCGTGCCCTGAGCGG - Intronic
1049396847 8:142404917-142404939 TGGAGGTGGTCTGCCCTGGGAGG - Intergenic
1049552246 8:143265848-143265870 TGGTGGCGGTGGGACCTGGTGGG - Intronic
1049555508 8:143279424-143279446 GGGTGGTGGTGTGGGCTTGGAGG - Intergenic
1052622074 9:30925402-30925424 TGTTGGCGGTGTGGCCTGGTGGG - Intergenic
1053045775 9:34915912-34915934 TGGTGGTGGGGTGGTGTGGGGGG - Intergenic
1054792527 9:69269372-69269394 TGTTGGTGGTGGGGCCTGGTGGG - Intergenic
1054963732 9:70998534-70998556 TGGTGGTGGTGTACACTCTGTGG + Intronic
1056063913 9:82913829-82913851 TGGTGCTGGTGAGCTGTGGGTGG - Intergenic
1056180566 9:84078562-84078584 TGGTGGTGGTGGGACATAGGCGG - Intergenic
1056677947 9:88692293-88692315 TGGTGGGTGGGTGACCTGGGTGG - Intergenic
1056966870 9:91170055-91170077 TGGTGGCAGGGGGCCCTGGGTGG + Intergenic
1056986345 9:91366794-91366816 GTGTGGTGGTGTGCATTGGGAGG + Intergenic
1057272428 9:93658542-93658564 AGGTGCTGGTGTGTCCTGGGAGG + Intronic
1057301938 9:93891532-93891554 TGGTGGGTGTGGGCTCTGGGTGG + Intergenic
1057845422 9:98518849-98518871 TGCTGAGTGTGTGCCCTGGGAGG + Intronic
1060572555 9:124655996-124656018 TGTTGGTGGTGGGGCCTGGTGGG + Intronic
1060930417 9:127486298-127486320 TGGGGGTGGGATGCCCTGGAAGG + Intronic
1061213223 9:129205408-129205430 TAGTGGTGGTGGGCACTGAGTGG + Intergenic
1061602493 9:131680527-131680549 TAGTGGTTTTCTGCCCTGGGTGG - Intronic
1061742978 9:132720932-132720954 TGTTGGTGGTGGGGCCTGGTGGG - Intergenic
1062051358 9:134448698-134448720 TGGTGGCAGGGGGCCCTGGGTGG + Intergenic
1062054516 9:134463905-134463927 TGGTGGTGTTGGGGCCAGGGAGG + Intergenic
1062261958 9:135667295-135667317 TGCTGGGGGTGTGCGCTGGGCGG + Intergenic
1062272653 9:135717001-135717023 TGGTGGTGGTGTGCATAGGACGG + Intronic
1062331308 9:136046079-136046101 TGGTGGTGCTGTGGCCTGAGCGG - Intronic
1203563107 Un_KI270744v1:74117-74139 TGGTGCTGGAGAGACCTGGGCGG + Intergenic
1185736924 X:2501706-2501728 TGGTCCTGGGGGGCCCTGGGAGG - Intronic
1186184299 X:7005100-7005122 GGGTGGTGGTGTGACCTGCCTGG + Intergenic
1186549933 X:10493026-10493048 TTGTGGTGGAGTGCCCTTGCAGG + Intronic
1186697079 X:12046721-12046743 GGAGGGTGGTGTGCCCAGGGAGG - Intergenic
1186869574 X:13757168-13757190 GGATGGTGGAGTTCCCTGGGTGG - Intronic
1187842649 X:23504929-23504951 TGGAGGTGGGGAGTCCTGGGGGG + Intergenic
1187952159 X:24481565-24481587 TGTTGGTGGTGGGGCCTGGTGGG + Intronic
1188607111 X:32044980-32045002 TGTTGGTGGTGGGGCCTGGCGGG + Intronic
1189578909 X:42384868-42384890 TGGTGGTGGTGTTTCCTGCAGGG + Intergenic
1189670319 X:43401203-43401225 AAGTGGTTTTGTGCCCTGGGTGG - Intergenic
1191030172 X:55961258-55961280 CTGTGGTGGTGAGGCCTGGGTGG - Intergenic
1191160929 X:57329321-57329343 TGGAGGTGGGGTGCTCTGGTTGG + Intronic
1191733388 X:64363295-64363317 TGTTGGTGGTGGGGCCTGGTGGG + Intronic
1192145665 X:68680640-68680662 TGTTGGTGCTGTGCCCTGCCAGG + Intronic
1193704228 X:84801553-84801575 TGGTGGAGGTGAGGCCTGGTGGG + Intergenic
1194004597 X:88474907-88474929 TGTTGGAGGTGTGGCCTGGTGGG - Intergenic
1194072779 X:89348346-89348368 TGGTGGAGGTGGGGCCTGGTGGG + Intergenic
1195982641 X:110596078-110596100 TGGTGGTGGTGTTTGATGGGGGG - Intergenic
1196910867 X:120483033-120483055 TGTTGGTGGGGTGACATGGGTGG - Intergenic
1196934185 X:120713271-120713293 TGTTGGTGGTGTGGCCTGGTGGG + Intergenic
1197623494 X:128778800-128778822 TGGTGGTGATGTCCACAGGGAGG - Intergenic
1198169720 X:134093802-134093824 TGGTGGGGGTGGGTCCTGGCAGG - Intergenic
1198714743 X:139545073-139545095 TGGTGGTGATTAGCTCTGGGTGG - Intronic
1199769150 X:150963118-150963140 TGGTGGGGGTATGTCCTGGTGGG - Intergenic
1200308136 X:155049330-155049352 TGGTGGTGAAGTCCCCTGGGTGG - Intronic
1200727018 Y:6684086-6684108 TGGTGGAGGTGGGGCCTGGTGGG + Intergenic
1200728170 Y:6699861-6699883 TGGTGGAGGTGGGGCCTGGTGGG + Intergenic
1200766066 Y:7081832-7081854 TGCTGGAGGTGGGCCCTGGTGGG - Intronic
1201073365 Y:10169738-10169760 TGGTGGTGGTGTGCTGTGTCTGG + Intergenic
1201286044 Y:12379573-12379595 TGTTGGTGGTGGGGCCTGGGGGG - Intergenic
1201343357 Y:12957076-12957098 TGTTGGAGGTGTGTCCTGGTTGG - Intergenic
1202045831 Y:20736659-20736681 TGCTGGAGGTGGGCCCTGGTGGG - Intergenic
1202369494 Y:24187343-24187365 CAGTGGTGATGTGGCCTGGGAGG - Intergenic
1202501291 Y:25482774-25482796 CAGTGGTGATGTGGCCTGGGAGG + Intergenic