ID: 906133316

View in Genome Browser
Species Human (GRCh38)
Location 1:43475665-43475687
Sequence AGGAAAGCGAAAGGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906133316_906133322 -5 Left 906133316 1:43475665-43475687 CCTTCCTCCCCTTTCGCTTTCCT No data
Right 906133322 1:43475683-43475705 TTCCTAGGAGAGCCCCCGCATGG No data
906133316_906133330 24 Left 906133316 1:43475665-43475687 CCTTCCTCCCCTTTCGCTTTCCT No data
Right 906133330 1:43475712-43475734 CCAGTGGAGTCCTTGTCTCCTGG No data
906133316_906133326 8 Left 906133316 1:43475665-43475687 CCTTCCTCCCCTTTCGCTTTCCT No data
Right 906133326 1:43475696-43475718 CCCCGCATGGTCTATGCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906133316 Original CRISPR AGGAAAGCGAAAGGGGAGGA AGG (reversed) Intergenic