ID: 906133318

View in Genome Browser
Species Human (GRCh38)
Location 1:43475669-43475691
Sequence TCCTAGGAAAGCGAAAGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906133318_906133322 -9 Left 906133318 1:43475669-43475691 CCTCCCCTTTCGCTTTCCTAGGA No data
Right 906133322 1:43475683-43475705 TTCCTAGGAGAGCCCCCGCATGG No data
906133318_906133330 20 Left 906133318 1:43475669-43475691 CCTCCCCTTTCGCTTTCCTAGGA No data
Right 906133330 1:43475712-43475734 CCAGTGGAGTCCTTGTCTCCTGG No data
906133318_906133326 4 Left 906133318 1:43475669-43475691 CCTCCCCTTTCGCTTTCCTAGGA No data
Right 906133326 1:43475696-43475718 CCCCGCATGGTCTATGCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906133318 Original CRISPR TCCTAGGAAAGCGAAAGGGG AGG (reversed) Intergenic
No off target data available for this crispr