ID: 906133322

View in Genome Browser
Species Human (GRCh38)
Location 1:43475683-43475705
Sequence TTCCTAGGAGAGCCCCCGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906133314_906133322 -1 Left 906133314 1:43475661-43475683 CCACCCTTCCTCCCCTTTCGCTT No data
Right 906133322 1:43475683-43475705 TTCCTAGGAGAGCCCCCGCATGG No data
906133315_906133322 -4 Left 906133315 1:43475664-43475686 CCCTTCCTCCCCTTTCGCTTTCC No data
Right 906133322 1:43475683-43475705 TTCCTAGGAGAGCCCCCGCATGG No data
906133316_906133322 -5 Left 906133316 1:43475665-43475687 CCTTCCTCCCCTTTCGCTTTCCT No data
Right 906133322 1:43475683-43475705 TTCCTAGGAGAGCCCCCGCATGG No data
906133318_906133322 -9 Left 906133318 1:43475669-43475691 CCTCCCCTTTCGCTTTCCTAGGA No data
Right 906133322 1:43475683-43475705 TTCCTAGGAGAGCCCCCGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906133322 Original CRISPR TTCCTAGGAGAGCCCCCGCA TGG Intergenic
No off target data available for this crispr