ID: 906133326

View in Genome Browser
Species Human (GRCh38)
Location 1:43475696-43475718
Sequence CCCCGCATGGTCTATGCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906133314_906133326 12 Left 906133314 1:43475661-43475683 CCACCCTTCCTCCCCTTTCGCTT No data
Right 906133326 1:43475696-43475718 CCCCGCATGGTCTATGCCAGTGG No data
906133320_906133326 0 Left 906133320 1:43475673-43475695 CCCTTTCGCTTTCCTAGGAGAGC No data
Right 906133326 1:43475696-43475718 CCCCGCATGGTCTATGCCAGTGG No data
906133319_906133326 1 Left 906133319 1:43475672-43475694 CCCCTTTCGCTTTCCTAGGAGAG No data
Right 906133326 1:43475696-43475718 CCCCGCATGGTCTATGCCAGTGG No data
906133318_906133326 4 Left 906133318 1:43475669-43475691 CCTCCCCTTTCGCTTTCCTAGGA No data
Right 906133326 1:43475696-43475718 CCCCGCATGGTCTATGCCAGTGG No data
906133321_906133326 -1 Left 906133321 1:43475674-43475696 CCTTTCGCTTTCCTAGGAGAGCC No data
Right 906133326 1:43475696-43475718 CCCCGCATGGTCTATGCCAGTGG No data
906133316_906133326 8 Left 906133316 1:43475665-43475687 CCTTCCTCCCCTTTCGCTTTCCT No data
Right 906133326 1:43475696-43475718 CCCCGCATGGTCTATGCCAGTGG No data
906133315_906133326 9 Left 906133315 1:43475664-43475686 CCCTTCCTCCCCTTTCGCTTTCC No data
Right 906133326 1:43475696-43475718 CCCCGCATGGTCTATGCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906133326 Original CRISPR CCCCGCATGGTCTATGCCAG TGG Intergenic
No off target data available for this crispr