ID: 906133330

View in Genome Browser
Species Human (GRCh38)
Location 1:43475712-43475734
Sequence CCAGTGGAGTCCTTGTCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906133323_906133330 4 Left 906133323 1:43475685-43475707 CCTAGGAGAGCCCCCGCATGGTC No data
Right 906133330 1:43475712-43475734 CCAGTGGAGTCCTTGTCTCCTGG No data
906133328_906133330 -9 Left 906133328 1:43475698-43475720 CCGCATGGTCTATGCCAGTGGAG No data
Right 906133330 1:43475712-43475734 CCAGTGGAGTCCTTGTCTCCTGG No data
906133316_906133330 24 Left 906133316 1:43475665-43475687 CCTTCCTCCCCTTTCGCTTTCCT No data
Right 906133330 1:43475712-43475734 CCAGTGGAGTCCTTGTCTCCTGG No data
906133321_906133330 15 Left 906133321 1:43475674-43475696 CCTTTCGCTTTCCTAGGAGAGCC No data
Right 906133330 1:43475712-43475734 CCAGTGGAGTCCTTGTCTCCTGG No data
906133324_906133330 -6 Left 906133324 1:43475695-43475717 CCCCCGCATGGTCTATGCCAGTG No data
Right 906133330 1:43475712-43475734 CCAGTGGAGTCCTTGTCTCCTGG No data
906133314_906133330 28 Left 906133314 1:43475661-43475683 CCACCCTTCCTCCCCTTTCGCTT No data
Right 906133330 1:43475712-43475734 CCAGTGGAGTCCTTGTCTCCTGG No data
906133315_906133330 25 Left 906133315 1:43475664-43475686 CCCTTCCTCCCCTTTCGCTTTCC No data
Right 906133330 1:43475712-43475734 CCAGTGGAGTCCTTGTCTCCTGG No data
906133325_906133330 -7 Left 906133325 1:43475696-43475718 CCCCGCATGGTCTATGCCAGTGG No data
Right 906133330 1:43475712-43475734 CCAGTGGAGTCCTTGTCTCCTGG No data
906133320_906133330 16 Left 906133320 1:43475673-43475695 CCCTTTCGCTTTCCTAGGAGAGC No data
Right 906133330 1:43475712-43475734 CCAGTGGAGTCCTTGTCTCCTGG No data
906133327_906133330 -8 Left 906133327 1:43475697-43475719 CCCGCATGGTCTATGCCAGTGGA No data
Right 906133330 1:43475712-43475734 CCAGTGGAGTCCTTGTCTCCTGG No data
906133319_906133330 17 Left 906133319 1:43475672-43475694 CCCCTTTCGCTTTCCTAGGAGAG No data
Right 906133330 1:43475712-43475734 CCAGTGGAGTCCTTGTCTCCTGG No data
906133318_906133330 20 Left 906133318 1:43475669-43475691 CCTCCCCTTTCGCTTTCCTAGGA No data
Right 906133330 1:43475712-43475734 CCAGTGGAGTCCTTGTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906133330 Original CRISPR CCAGTGGAGTCCTTGTCTCC TGG Intergenic
No off target data available for this crispr