ID: 906141917

View in Genome Browser
Species Human (GRCh38)
Location 1:43539007-43539029
Sequence AAGAATGAACGGATGGGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 252}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906141917_906141922 18 Left 906141917 1:43539007-43539029 CCATTGCCCATCCGTTCATTCTT 0: 1
1: 0
2: 0
3: 21
4: 252
Right 906141922 1:43539048-43539070 ATGCCTGCTGTGAAATAAAGTGG 0: 1
1: 0
2: 1
3: 15
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906141917 Original CRISPR AAGAATGAACGGATGGGCAA TGG (reversed) Intronic
902035492 1:13454967-13454989 AAGAAAGAACTGAAGGGAAAGGG - Intergenic
902303312 1:15518545-15518567 AATAATGAACAGATCAGCAAAGG - Intronic
902474746 1:16676552-16676574 AAAAATTAGCGGATGGGGAATGG + Intergenic
902783217 1:18717387-18717409 ACTAATGAACGGGTGGGGAACGG - Intronic
902790551 1:18764988-18765010 ATGAATGAATGCATGGGGAAGGG - Intergenic
903234459 1:21940659-21940681 ATGAATGAATGAATGGACAAAGG - Intergenic
903298637 1:22362383-22362405 AAGACTGAATGGATGGTCATTGG - Intergenic
905178707 1:36153941-36153963 AAAAATGAACAGATAGGCCAGGG - Intronic
905493653 1:38365511-38365533 AAGAATGGATGGATGGTGAAGGG - Intergenic
906141917 1:43539007-43539029 AAGAATGAACGGATGGGCAATGG - Intronic
907086605 1:51681396-51681418 AAAAATGAACATATAGGCAACGG + Intronic
907305280 1:53509723-53509745 GAGAATGACCGGCTGGGCACTGG - Intronic
907419859 1:54339926-54339948 AAGAAAGAACGAAAGGGGAAAGG + Intronic
907837125 1:58120599-58120621 AAGAAGGAAAGGGTGGACAAGGG - Intronic
908156338 1:61357502-61357524 AAGAATGAAGGAAAGGGCAGAGG - Intronic
909524313 1:76605880-76605902 AAAAAAAAAAGGATGGGCAAAGG + Intronic
911709607 1:101054830-101054852 AAGAATGAAGAGAAGGGCAAAGG - Intergenic
911965196 1:104360023-104360045 AAGAATGAAGGGAGGGGTCAGGG + Intergenic
912511382 1:110192455-110192477 AAGAAGGCAGGGGTGGGCAATGG - Intronic
913514434 1:119591176-119591198 AAGAAAGAACAGAGGAGCAAAGG + Intergenic
913544969 1:119859206-119859228 AAGAATGAAACGGTGGGAAAGGG + Intergenic
913662293 1:121015108-121015130 AAAAATTAGCGGATGGGGAATGG + Intergenic
914013670 1:143798293-143798315 AAAAATTAGCGGATGGGGAATGG + Intergenic
914652294 1:149706902-149706924 AAAAATTAGCGGATGGGGAATGG + Intergenic
916339315 1:163710955-163710977 AAGAATGAAGGGAAGGGAAGGGG - Intergenic
918375727 1:183907356-183907378 GAGAATGAATGGTTGGGTAAGGG - Intronic
919996543 1:202756914-202756936 AAGAATGAAAGGATGGACTCAGG - Intronic
922326972 1:224536954-224536976 ATGAATCAACGCATGAGCAAAGG + Intronic
922790597 1:228308871-228308893 AAGAATGAATGGATGGATAATGG - Intronic
923216797 1:231856116-231856138 AAGAATGATCAGATGGGAGATGG + Intronic
1063103673 10:2973722-2973744 AAGAATGAAAGGAAGGGAAGTGG - Intergenic
1063655687 10:7986071-7986093 GAGAATGAAAGGCTGGGCATGGG - Intronic
1063684781 10:8226337-8226359 AGGAATGAAAGAATGGGAAATGG - Intergenic
1063761625 10:9084990-9085012 AAGAAAGAATGTTTGGGCAAGGG + Intergenic
1064655593 10:17552350-17552372 AAGAAGGAACAGAAAGGCAATGG - Intergenic
1064697869 10:17986657-17986679 AAGAATGAACAGATTTGCTATGG - Intronic
1064934771 10:20667435-20667457 AAGAAGGAATGAATGGACAATGG - Intergenic
1065423619 10:25575662-25575684 AAGAATGAATGGAATGGCCAGGG - Intronic
1066373431 10:34836643-34836665 AAGAATGTACGGAGGCCCAAGGG - Intergenic
1068653468 10:59549823-59549845 ATGAATGATCTGATGGGCAGGGG + Intergenic
1069210343 10:65750647-65750669 AATATTGAACTGATGGCCAACGG - Intergenic
1069914050 10:71776293-71776315 AAGAATGGACAGATGGGCAGGGG - Intronic
1074280670 10:112048633-112048655 AAGCAGGAAGGGATGGGAAAAGG + Intergenic
1074625018 10:115173797-115173819 AACAATAAAGGGATGAGCAAAGG - Intronic
1080968073 11:37237243-37237265 ATGAATGAAAGGATATGCAATGG - Intergenic
1082177542 11:49078682-49078704 AAGAAGGAAAGGATGGGGGAGGG - Intergenic
1083604999 11:63973241-63973263 AAGAAGGAAGGGATGGGGGAGGG + Intergenic
1083692344 11:64417598-64417620 ATGAATTAAAGAATGGGCAAAGG + Intergenic
1084524934 11:69690899-69690921 AAGAAAGAAAGGAAGGGCCAGGG + Intergenic
1085308251 11:75500556-75500578 AAGAAGGATGTGATGGGCAAGGG - Intronic
1086453337 11:86938411-86938433 AAGAATGAGCAGAAGGGCCACGG + Intronic
1090675174 11:128985678-128985700 ATGAATGAATGGATGGACAAAGG - Intronic
1091579235 12:1771734-1771756 AAGAATGAACACAGAGGCAATGG - Intronic
1091949015 12:4576160-4576182 AAGGATGAATAGATGGACAATGG - Intronic
1092712061 12:11349490-11349512 AAGCAAGAGTGGATGGGCAAAGG - Intergenic
1093483118 12:19625671-19625693 AAGAAGGGAGGGAGGGGCAAGGG - Intronic
1093805421 12:23426790-23426812 AAGAAAGTATGGATGAGCAACGG - Intergenic
1095596089 12:43959938-43959960 AAGAATGGACGACTGGGAAAGGG + Intronic
1098384456 12:69904126-69904148 AAGTATGGAAGGAAGGGCAATGG - Intronic
1099418942 12:82428305-82428327 AGGAGAGAACGGATGGGTAAAGG + Intronic
1102785952 12:115604959-115604981 AAGAATAGATGGATGGACAATGG + Intergenic
1103960199 12:124604583-124604605 AAGAATGAATGTATGGGGCATGG - Intergenic
1104391426 12:128393802-128393824 AAGAAAGGGCGAATGGGCAAAGG + Intronic
1104499300 12:129269395-129269417 AAGAAGGAAGGGAAGGGGAAGGG - Intronic
1106041487 13:26097644-26097666 AAGAATGAAAAGCAGGGCAATGG - Intergenic
1106057219 13:26249694-26249716 ATGAATGAACAGATGGATAATGG - Intergenic
1106598187 13:31164793-31164815 AAGGAGGAAGAGATGGGCAAAGG + Intergenic
1109033458 13:57224226-57224248 AAGAATGAAAGGAGGGAGAAAGG + Intergenic
1109357840 13:61254823-61254845 AAAAATATACTGATGGGCAAAGG + Intergenic
1109367048 13:61369226-61369248 AAGAATGAAAACATGGGCACAGG + Intergenic
1111648136 13:91057657-91057679 AAGAAAGAAGGGAAGGGAAAGGG + Intergenic
1112548012 13:100390543-100390565 AAGATTTAAAGGATGGGCAGAGG + Intronic
1113036619 13:106056866-106056888 AAAAAGGAACGGATAGGCAATGG - Intergenic
1114585831 14:23812833-23812855 AAGAATGAACTTGTGGGAAAGGG - Intergenic
1115364788 14:32545857-32545879 AAGAATGATCTGAAAGGCAATGG + Exonic
1115460924 14:33659853-33659875 AAAAATCAAAGGATGGTCAATGG + Intronic
1115935111 14:38543548-38543570 AGGAATGAAAGGCTGGGTAAAGG - Intergenic
1117110706 14:52451086-52451108 AAGAATGAAATAATGGGCATTGG + Intronic
1118360532 14:65053112-65053134 AAGAATGAATGGAAGAGGAAGGG + Intronic
1118597564 14:67447888-67447910 AGGAATGAAGGGGTGGGCGAGGG - Intronic
1119857974 14:77915147-77915169 AGCAATGAAGGGATGGACAATGG - Intronic
1119938619 14:78616702-78616724 AAGAGGGCACAGATGGGCAAGGG + Intronic
1119962513 14:78875818-78875840 AAGAATGAGTGAATGAGCAAAGG + Intronic
1120135944 14:80868787-80868809 AAAAATGAAGGGATGGAAAAAGG + Intronic
1121786872 14:96668533-96668555 ATGAATGAACTGATGGGGGACGG - Intergenic
1121925703 14:97925505-97925527 CAGAATGAACAGATGGGTAATGG - Intergenic
1122345623 14:101057780-101057802 AAAAATGGACAGATGGGAAAAGG - Intergenic
1122390433 14:101377434-101377456 AAGAATAAAGGGAAGCGCAAAGG - Intergenic
1122455097 14:101844050-101844072 AAGAATGATCGTAGGGGCAAAGG - Intronic
1122810874 14:104287299-104287321 CAGACTGAAGGGGTGGGCAAGGG + Intergenic
1123416195 15:20097384-20097406 GACAATGAACCGATGGGCCAAGG + Intergenic
1123525535 15:21104489-21104511 GACAATGAACCGATGGGCCAAGG + Intergenic
1126890822 15:53202344-53202366 AAGAAAGAACGAAAGGACAAAGG + Intergenic
1127978514 15:64016795-64016817 AAGAAAGAAGGGAAGGGGAAGGG + Intronic
1128509059 15:68302499-68302521 AAGAATGAACCCAAGAGCAAGGG - Exonic
1128874546 15:71191460-71191482 AATAATTAACAGATGGGCAAAGG - Intronic
1128948963 15:71854785-71854807 AAGAATGAAGGCAGTGGCAAAGG + Intronic
1131423509 15:92326710-92326732 AAGAATGAACAAAGGGGAAATGG - Intergenic
1131506842 15:93026851-93026873 AGGAATGAAAGGAGGGGCAAAGG + Exonic
1131759976 15:95612012-95612034 AATACTCAACAGATGGGCAAAGG - Intergenic
1132042065 15:98533563-98533585 AAAAATGAATGCATGGGCAAAGG - Intergenic
1133121413 16:3611158-3611180 ATGAATGAATGGATCGGTAAGGG + Intronic
1134428070 16:14172133-14172155 AAGGATGAAGGGATGGGAATGGG - Intronic
1134488468 16:14677903-14677925 AAGAATGAATGGATGGATGATGG + Intronic
1134554788 16:15155436-15155458 ATAAATGAATGGATGGGGAATGG - Intergenic
1135823849 16:25708838-25708860 AAAAATGGAAGGATGGGAAAAGG - Intronic
1137004605 16:35262638-35262660 AGGAATGAAGGGATGGGGAGAGG + Intergenic
1140093623 16:71856771-71856793 AAGAATATACGGATAGGGAATGG + Exonic
1140117247 16:72053054-72053076 AACAATTAAAGCATGGGCAAAGG - Intronic
1142025710 16:87812386-87812408 GAAAATGAACGGATGGGCCCGGG + Intergenic
1144329419 17:14210901-14210923 AAGAATGAATGGATTTGGAAAGG + Intergenic
1147457302 17:40545887-40545909 AAGAAAGAACGGGTGGGGAGTGG - Intergenic
1151445659 17:74161783-74161805 AAGAATTCAGGGATGGGCAGTGG + Intergenic
1152982053 18:287732-287754 AAGACTGAACGGTTAGGCACGGG - Intergenic
1153352704 18:4098548-4098570 AAGAAAGAACAAATGGGAAATGG + Intronic
1153381338 18:4442993-4443015 ATGAATGAATGGATTGACAATGG + Intronic
1153625073 18:7015749-7015771 AAGAATGTGAGGATGGGCACTGG - Exonic
1155008544 18:21751673-21751695 AAGAAAGAAAGGAAGGGGAAAGG - Intronic
1160098712 18:75900926-75900948 GAGAAGGAAGGGAAGGGCAAAGG + Intergenic
1160502432 18:79408802-79408824 ATGAATGAATGGATAGGGAATGG - Intronic
1160502455 18:79408928-79408950 ATGAATGAATGGATAGGGAATGG - Intronic
1160502478 18:79409057-79409079 ATGAATGAATGGATAGGGAATGG - Intronic
1160502523 18:79409313-79409335 ATGAATGAATGGATAGGGAATGG - Intronic
1162059985 19:8088715-8088737 AAGCATGAATGAATGAGCAAAGG + Intronic
1162135985 19:8555599-8555621 AGGAATGAATGGCTGGGCCATGG - Intronic
1164763780 19:30747442-30747464 ATGTATGAACTCATGGGCAATGG - Intergenic
1164792028 19:30995487-30995509 AAGAATTAGCTGATGGGCATGGG - Intergenic
1165197427 19:34115864-34115886 AAAAATAAAAAGATGGGCAAAGG + Intergenic
1165732659 19:38156392-38156414 AAGAGGGAAGGGAAGGGCAATGG - Intronic
1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG + Intronic
1167240842 19:48342212-48342234 AAGAAGGAAGGGAAGGGAAAGGG + Intronic
1168042247 19:53768058-53768080 AAGTGTGAACAGAAGGGCAAAGG - Intergenic
1168660578 19:58162633-58162655 AAGACAGAATGGATGGGCAAGGG + Intergenic
925002288 2:414320-414342 AACAATTAACACATGGGCAATGG - Intergenic
926643572 2:15264074-15264096 AAGAAAGAATGGAAGAGCAAAGG + Intronic
929137346 2:38637575-38637597 AAGAAAGAAAGGATGGGGGAGGG + Intergenic
929277109 2:40037787-40037809 ATGAATGAATGGAAGGGCATTGG + Intergenic
930277596 2:49331771-49331793 AGGAATGAAGGAAGGGGCAAGGG + Intergenic
931639916 2:64372852-64372874 AAGAATGAATGGAAGTTCAAAGG - Intergenic
932401883 2:71486403-71486425 AAGAATAAAAGGAGGGGCACAGG - Intronic
932451330 2:71812569-71812591 ATGAATGAATGAATGTGCAAAGG - Intergenic
932482060 2:72048966-72048988 AAGAATGAAGGAAAGGGAAAAGG + Intergenic
932544540 2:72694149-72694171 AAGAATGAACTGGTGGGGCATGG + Intronic
932842528 2:75096815-75096837 AAGAATGAGTGGATGTGCAGAGG - Intronic
933359809 2:81267126-81267148 TAGAATGTAAGGAAGGGCAAGGG + Intergenic
933887693 2:86735109-86735131 AAGAATGAATGGATAAACAATGG - Intronic
933922484 2:87061603-87061625 AAGAATGAATGGATAAACAACGG + Intergenic
935782255 2:106518670-106518692 AGGAATGAATGGATGGTGAATGG - Intergenic
937329083 2:121012879-121012901 GAAAATGAAAGGATGGGGAAAGG + Intergenic
937600658 2:123727555-123727577 AAGAAGGAACGCATGGGTGAAGG - Intergenic
938149284 2:128868127-128868149 AAGGATGAACACATGGGCATGGG - Intergenic
939092184 2:137792109-137792131 CAGAAGGAAAGGAGGGGCAAGGG + Intergenic
941563380 2:167077526-167077548 AATAATGAATGGAAGGGCATAGG + Intronic
941613850 2:167696091-167696113 AAGAATGAAAGAATGGACATTGG + Intergenic
941949813 2:171143111-171143133 ATGAATGCACGAATGGACAAAGG + Intronic
942174892 2:173323805-173323827 AAGAAGGAAAGGAAGGGGAAGGG - Intergenic
945265817 2:207890097-207890119 AAAAATGAACGAATAGGCAGGGG - Intronic
945923579 2:215780655-215780677 AAGAATGAAATAAAGGGCAAAGG - Intergenic
948743624 2:240068159-240068181 AAGAATGAACATATGAGCAAAGG - Intergenic
1169514998 20:6306748-6306770 AAGAAGGAAGGGAAGGGGAAGGG - Intergenic
1170531565 20:17297805-17297827 AAAAATGAAGGAATGAGCAAAGG - Intronic
1171302357 20:24074716-24074738 AAGAATGAACTGAGAGGAAAAGG + Intergenic
1171813382 20:29762973-29762995 AAGAAAGAACGGATGGACCGAGG + Intergenic
1172783316 20:37450184-37450206 ATGGATGAATGGATGGACAAAGG - Intergenic
1174412604 20:50345737-50345759 AAGAATGAAAGGAGGGGCCTCGG + Intergenic
1174515167 20:51086288-51086310 AAAAATGAAGTGATGGGAAAGGG - Intergenic
1174707012 20:52667488-52667510 AAGATTGAATGGGTGGGAAAAGG - Intergenic
1175792419 20:61748555-61748577 AAGAATGAAGAGCTGGGAAAAGG + Intronic
1176918869 21:14662196-14662218 AATCATGAAAGGAAGGGCAAGGG - Intergenic
1177651622 21:23966677-23966699 GAGCATGAAGGGATGGGCTATGG - Intergenic
1180146832 21:45925622-45925644 AAAAATGAAAGAATGGGAAAAGG + Intronic
1181982673 22:26776802-26776824 AATAAAGAACAGATGGGAAATGG - Intergenic
1182674684 22:32029624-32029646 CAGAAAGAATGCATGGGCAAAGG + Intergenic
1182825708 22:33262889-33262911 AAGAAAGAACGGAAGGGGAGGGG - Intronic
1184321301 22:43744104-43744126 ATGAATGAATGGATGGGTTATGG + Intronic
949187837 3:1215046-1215068 AAAAGTGAAAGGATGGGCACAGG - Intronic
951551310 3:23877981-23878003 AAGAATGAAGGAAGGGGCAGAGG - Intronic
952868691 3:37877479-37877501 ACCAATGAATGGATAGGCAAAGG - Intronic
955665652 3:61346667-61346689 AAGAAGGAAAGGATGGGGAGAGG + Intergenic
955972738 3:64451933-64451955 AGGAATAAAAGAATGGGCAAGGG + Intergenic
958186487 3:90126883-90126905 AAGATTTAAAGGATGGGCAAAGG - Intergenic
959813504 3:110647256-110647278 AAGAATGAGGCCATGGGCAAAGG + Intergenic
961207114 3:125093377-125093399 AAGAAGGAAGGGCTGGGCAGAGG - Intronic
961241069 3:125412081-125412103 AACATTTAAGGGATGGGCAAAGG + Intergenic
962859588 3:139387286-139387308 AAGAAAGAACGAACAGGCAAGGG + Intronic
963892650 3:150653016-150653038 AAGAATGAAGTGATAGGAAAGGG - Intergenic
964333387 3:155628469-155628491 AAGAATGATGGGATGGCAAAAGG - Intronic
964743467 3:159990068-159990090 AAGCATGAATGGATGGGTGAAGG + Intronic
967978432 3:195048658-195048680 ATGACTGGACGGATGGGCGATGG - Intergenic
969966958 4:11006563-11006585 AAGAATGAAGGGATTGGAGAGGG - Intergenic
970038154 4:11763597-11763619 AAGAAAGAATGGAAGGGAAAGGG - Intergenic
973148563 4:46860349-46860371 CAGATTGAGCTGATGGGCAAGGG + Intronic
974628728 4:64456528-64456550 ATGGATGATTGGATGGGCAAAGG + Intergenic
975653200 4:76614944-76614966 AAGAGGGAAGGGATTGGCAAAGG - Intronic
976029247 4:80730909-80730931 AAGAATAAAGGCATGTGCAAAGG - Intronic
976781462 4:88763264-88763286 ATGAATGAACGAATGGGAAAGGG - Intronic
981586900 4:146313198-146313220 AAGAAGGAACCAAAGGGCAAGGG + Intronic
982241729 4:153306577-153306599 AAGAAGGAATAGATGGGGAATGG + Intronic
984056759 4:174939989-174940011 AAGAAAGAAAGGATGGAGAAAGG - Intronic
984488302 4:180400756-180400778 AAGAAGGAAGAGAAGGGCAAGGG - Intergenic
987797956 5:22654129-22654151 AAGAAAGAAAGGAAGGGGAAGGG - Intronic
990521686 5:56587465-56587487 ATGAATGAATGGATGGGATAGGG - Intronic
990852984 5:60228037-60228059 AAGAGTAAAGTGATGGGCAATGG - Intronic
991108748 5:62872783-62872805 AAGAAAGAAAGGATAAGCAAAGG + Intergenic
991633012 5:68675530-68675552 AAGAGTGAACAAATGGGGAAGGG - Intergenic
995041668 5:107594868-107594890 GAGAATGAACGGTTGAGCAATGG - Intronic
996542791 5:124647784-124647806 AAGAATGAAGGGCTGGCAAATGG - Exonic
997222199 5:132178754-132178776 AAGAGGGAAGGGAAGGGCAATGG - Intergenic
997672460 5:135686721-135686743 AAGAATGAATGAATGGAAAAAGG + Intergenic
997818269 5:137038525-137038547 AAGAAGGCAGGGAAGGGCAAAGG + Intronic
998416867 5:141952452-141952474 GAGAATGAAGGTCTGGGCAAGGG + Intronic
999840870 5:155425183-155425205 AAGAATGAAAGGATTGGAAATGG + Intergenic
1000156083 5:158553153-158553175 AAGAAAGAATGGATAAGCAAAGG - Intergenic
1001565626 5:172697476-172697498 AAGGATGGACGGACAGGCAAAGG + Intergenic
1001633303 5:173192482-173192504 ATGAATGAAGGGAGGGGGAAGGG + Intergenic
1003709641 6:8574975-8574997 AAGAATGAAAGGAAGAGAAAGGG - Intergenic
1003809834 6:9767573-9767595 AAGCATGAAAGAGTGGGCAATGG - Intronic
1005277730 6:24238092-24238114 AAGAAAGAAGGGAAGGGGAAGGG + Intronic
1005695043 6:28343938-28343960 AAGCATGAAAAGATGGACAAAGG + Intronic
1007590670 6:43018880-43018902 AAGATTGAACCGAAGGGGAAGGG + Exonic
1008274786 6:49530199-49530221 AAAAATGGAGGGATGGTCAATGG + Intergenic
1008863211 6:56176846-56176868 AAGAATGAAGGGAGAGGAAAGGG + Intronic
1008963982 6:57295894-57295916 AAGAATGGAGGGATGGGAATAGG + Intergenic
1009996137 6:70897324-70897346 AAGAATGAAAAGATGAGCCACGG - Intronic
1010086105 6:71919792-71919814 AAGAATGAAAGGCTGTTCAATGG + Intronic
1010254125 6:73738703-73738725 AAGACTGAAAAGTTGGGCAAGGG - Intronic
1012253003 6:97000044-97000066 AAGAATGCAAAGATGGCCAATGG + Intronic
1013139760 6:107321203-107321225 ATGAATGAATGAATGAGCAAAGG + Intronic
1013826949 6:114224144-114224166 GAAAATGAAAGGATAGGCAAAGG - Intronic
1014427211 6:121323140-121323162 ATGATTGAGTGGATGGGCAAGGG - Intronic
1015784736 6:136910736-136910758 AAGCATGAAAGGCTGGGAAATGG + Intronic
1017843033 6:158237550-158237572 AAGAAGGATCAGATGGGAAAAGG - Intronic
1019960972 7:4459129-4459151 AAGAATGAAGGGGTGGGGGAGGG + Intergenic
1021845168 7:24757010-24757032 AAGGATGAACGAATGGGGAGGGG + Intronic
1022014241 7:26335411-26335433 AAGAAGAAAGGGCTGGGCAATGG - Intronic
1022055542 7:26729699-26729721 AAGAATAAGGGGATGGGGAAGGG + Intronic
1024281707 7:47724258-47724280 AAGCATGAACGAATGGCCGAAGG - Intronic
1024320669 7:48065179-48065201 AAAAATGAAATGATGAGCAAAGG + Intergenic
1026648656 7:72195215-72195237 AAGAATGCACAGAGGAGCAAGGG - Intronic
1028191995 7:87864666-87864688 GAAAATGAAGGGATGGGGAAAGG - Intronic
1030501616 7:110366570-110366592 AAGAATGAGGTGAGGGGCAATGG + Intergenic
1031196150 7:118616569-118616591 AAGAAAGCACGGATGGGGAGAGG + Intergenic
1031327034 7:120414684-120414706 AAGAATGATCGTATGGGTGAGGG - Intronic
1032463453 7:132128508-132128530 CAGGATGAATGGATGAGCAAGGG + Exonic
1032936684 7:136740338-136740360 AAGAATGAAATGAAGGGAAATGG + Intergenic
1033945413 7:146710386-146710408 AAGAATGAAGGGATGAGAATAGG - Intronic
1034112915 7:148555819-148555841 ATGAAAGAACGGGTGGGCCATGG - Intergenic
1034886609 7:154803416-154803438 AAGAATAAACGGAGGGAGAAAGG - Intronic
1038309868 8:26438123-26438145 AAGGATGAACGGATAAACAATGG + Intronic
1039351556 8:36769288-36769310 AAGAATGAACATATGTGAAAAGG - Intergenic
1041687889 8:60660951-60660973 AGAAATGATCGGATGGGGAAGGG - Intergenic
1041926342 8:63241424-63241446 ATCAATGAAGGGAAGGGCAATGG + Intergenic
1043310890 8:78858473-78858495 AACAATAAAAGGATGGACAAAGG + Intergenic
1043723396 8:83577456-83577478 AAGTTGGAACGGATGGGTAATGG + Intergenic
1046054638 8:109064553-109064575 AAGAATGAAGGAAATGGCAATGG - Intergenic
1050002183 9:1089362-1089384 AAGAACGAACGGAAGGGGCAAGG + Intergenic
1052741968 9:32402169-32402191 AAGAAGGAAGGAATGGGAAATGG - Intronic
1057283528 9:93729436-93729458 CAGAATGAACTGATGGGACAGGG - Intergenic
1057977424 9:99620893-99620915 AACAAGGAAGGGATGGGCCAAGG + Intergenic
1060552554 9:124492496-124492518 ATGAATGAATGAATGGGCAAAGG - Intronic
1061121270 9:128643979-128644001 AGGAATGAATGAATGGGCCAGGG + Intronic
1062664275 9:137659272-137659294 AAGCATGAAAAAATGGGCAAAGG - Intronic
1186358045 X:8807861-8807883 AAGAATGAATGGATGGGGATTGG - Intergenic
1186617455 X:11204294-11204316 AAGAATGAATGGATGGGGATTGG + Intronic
1186883091 X:13885807-13885829 AAGAATGAGCGGAGAAGCAAAGG + Intronic
1187070596 X:15883702-15883724 AAGAATGAATGGATGGGGATCGG - Intergenic
1187107216 X:16255950-16255972 AAGAATTTAGGGATGGGGAAAGG - Intergenic
1189256438 X:39643268-39643290 GAGAATGGACGGACCGGCAACGG + Intergenic
1190473506 X:50806073-50806095 ATGAATGAACAAAGGGGCAATGG + Intronic
1190835052 X:54092777-54092799 AAAAATGAAAGAATGGGCAAAGG - Intronic
1190928835 X:54931711-54931733 AAGAATGGAGGGAAGGGCAGAGG + Intergenic
1193141906 X:78036466-78036488 CAGAGTAAATGGATGGGCAAGGG + Intronic
1193999442 X:88409672-88409694 AAGAATGATACGATGGACAATGG - Intergenic
1194717668 X:97305844-97305866 AAGAAAGAAAGAATGGGAAATGG + Intronic