ID: 906143802

View in Genome Browser
Species Human (GRCh38)
Location 1:43548493-43548515
Sequence AATCTGCGGGAAGTCCCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 67}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906143802_906143807 -2 Left 906143802 1:43548493-43548515 CCCTGTGGGACTTCCCGCAGATT 0: 1
1: 0
2: 0
3: 5
4: 67
Right 906143807 1:43548514-43548536 TTCCGTTGCTTTCTCTCTCTGGG 0: 1
1: 0
2: 1
3: 39
4: 356
906143802_906143806 -3 Left 906143802 1:43548493-43548515 CCCTGTGGGACTTCCCGCAGATT 0: 1
1: 0
2: 0
3: 5
4: 67
Right 906143806 1:43548513-43548535 ATTCCGTTGCTTTCTCTCTCTGG 0: 1
1: 0
2: 0
3: 21
4: 210
906143802_906143810 21 Left 906143802 1:43548493-43548515 CCCTGTGGGACTTCCCGCAGATT 0: 1
1: 0
2: 0
3: 5
4: 67
Right 906143810 1:43548537-43548559 CCTGTTTTCCTATTGCACAATGG 0: 1
1: 0
2: 0
3: 18
4: 190
906143802_906143811 22 Left 906143802 1:43548493-43548515 CCCTGTGGGACTTCCCGCAGATT 0: 1
1: 0
2: 0
3: 5
4: 67
Right 906143811 1:43548538-43548560 CTGTTTTCCTATTGCACAATGGG 0: 1
1: 0
2: 4
3: 35
4: 329
906143802_906143812 23 Left 906143802 1:43548493-43548515 CCCTGTGGGACTTCCCGCAGATT 0: 1
1: 0
2: 0
3: 5
4: 67
Right 906143812 1:43548539-43548561 TGTTTTCCTATTGCACAATGGGG 0: 1
1: 0
2: 1
3: 28
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906143802 Original CRISPR AATCTGCGGGAAGTCCCACA GGG (reversed) Intronic
906143802 1:43548493-43548515 AATCTGCGGGAAGTCCCACAGGG - Intronic
907268056 1:53274793-53274815 AATCTGCGGGGACCCTCACAGGG + Intronic
913685915 1:121231911-121231933 AATGTGTGGAAAGTCCCAAAGGG + Intronic
914037767 1:144019514-144019536 AATGTGTGGAAAGTCCCAAAGGG + Intergenic
914151687 1:145048418-145048440 AATGTGTGGAAAGTCCCAAAGGG - Intronic
917968029 1:180190739-180190761 TATCTGCAGGTAGCCCCACACGG + Intronic
920473238 1:206250468-206250490 AATGTGTGGAAAGTCCCAAAGGG + Intronic
922547808 1:226471619-226471641 AATGTGCTGGGAATCCCACAGGG + Intergenic
1065396314 10:25242113-25242135 AATCTGCAGGAAAACCCAAAGGG + Intronic
1075104243 10:119527322-119527344 AATCTGCTGGAAGACCCAGAAGG - Exonic
1085236170 11:75017268-75017290 AAGCTCAGGGAAGTCTCACAAGG - Intronic
1086842127 11:91699223-91699245 AATCTGTGGGAGGACCCAAATGG - Intergenic
1089777804 11:120850968-120850990 AATGTGAGGGAAGCCCCAGATGG - Intronic
1090979515 11:131705258-131705280 AATCTGCTGATAGTCCTACAGGG - Intronic
1092277161 12:7070127-7070149 AAGCTGCTGGAAGTCCCAGAAGG + Exonic
1095960030 12:47828724-47828746 AGGCTGCGGGGAGTACCACAGGG + Intronic
1096048724 12:48587049-48587071 AATCAGAGGGAACTCCCCCACGG + Intergenic
1097462918 12:59886087-59886109 AATCTGGGGGAAATTCCAGATGG - Intergenic
1103560174 12:121789499-121789521 AATCTGCAGGAGGACACACAGGG + Intronic
1107376757 13:39811973-39811995 TAACTGCGGGGAGTCACACAGGG + Intergenic
1118990962 14:70796641-70796663 AATCTCCCGGAAGTCCAGCATGG - Intronic
1121975926 14:98404176-98404198 AGTCTGCCTGAAGTCCCCCAGGG + Intergenic
1122421038 14:101577541-101577563 ACTCTGCTGGAAGGGCCACAGGG + Intergenic
1128894163 15:71357444-71357466 AGTCTGCAGGGAGTCCCACTGGG - Intronic
1132769233 16:1551795-1551817 ACTCTGCGGGACCTCCCACCCGG + Intronic
1135517312 16:23147088-23147110 AAACAGCGTGAAGTCACACAGGG - Intronic
1142059706 16:88021308-88021330 ATTCTGCTGGAAGTCCCTCCGGG + Intronic
1142141099 16:88473242-88473264 AATCTCCGGGATGGCCCACTTGG + Intronic
1146478096 17:33179252-33179274 AATCTGCCAGAAATCTCACAGGG - Intronic
1156200227 18:34822206-34822228 AATCTGGGGAATGTCCCAAAGGG + Intronic
1156449044 18:37256195-37256217 TATCTGCGGGCCTTCCCACAGGG - Intronic
1166857977 19:45792691-45792713 AATCTCCGCGCAGTCCCCCATGG + Exonic
929611432 2:43273684-43273706 ACTCAGTGTGAAGTCCCACAGGG + Intronic
931550923 2:63445328-63445350 AATCTTTGGGAAATCCCACTGGG - Intronic
941099836 2:161283443-161283465 AATCTTAGGGAAGACACACATGG + Intergenic
1175191627 20:57215653-57215675 GCTCTGGGGGAAATCCCACACGG + Intronic
1176447785 21:6834830-6834852 CATCTGCAGAAACTCCCACAGGG + Intergenic
1176825955 21:13699856-13699878 CATCTGCAGAAACTCCCACAGGG + Intergenic
952195668 3:31073241-31073263 AATCTGCTGGAAGTGCCTTAGGG - Intergenic
952860555 3:37808831-37808853 CATCTGCTGGAAGAACCACATGG - Intronic
955782611 3:62501579-62501601 AATCTTCAGGAAATCCCACTTGG + Intronic
957189414 3:76987400-76987422 AATCAAAGGGAAGTCGCACATGG - Intronic
960299574 3:115985717-115985739 TTTCTACTGGAAGTCCCACATGG + Intronic
964594334 3:158406747-158406769 AATCTAGTGGAAGTCCCAAATGG + Intronic
978694012 4:111554026-111554048 AATCTGGAGGAAGACCCCCAGGG + Intergenic
985280761 4:188283636-188283658 AATCTTCTAAAAGTCCCACAAGG + Intergenic
994537368 5:101048821-101048843 AATGTCAGGGAAGTCACACAAGG + Intergenic
1003834026 6:10048385-10048407 AATCTGAGGGAAATTACACAAGG - Intronic
1006579059 6:35066062-35066084 AACCTGCCGAAAGTCACACAGGG - Intronic
1007224285 6:40302050-40302072 ACTCTGAGGCATGTCCCACATGG - Intergenic
1015158490 6:130125109-130125131 GATCTTGGGGAAGTCCCACAAGG + Intronic
1017766464 6:157610934-157610956 AGTCTCCAGAAAGTCCCACAGGG - Intronic
1017862530 6:158412355-158412377 AGTCTGAGGGAAGCCTCACAGGG - Intronic
1020642108 7:10768296-10768318 TATCTGTGGGAAATCTCACAAGG - Intergenic
1030365696 7:108643446-108643468 AAACTGCACGAAGTCCCCCAGGG - Intergenic
1039432483 8:37535706-37535728 AATATGCAGGGAGTCCCAAATGG - Intergenic
1039774834 8:40725090-40725112 AAACTGCGGGAAGTGCCATCAGG + Intronic
1041078035 8:54186999-54187021 AATCTGCTGGAAGTAGCAAAGGG + Intergenic
1042911426 8:73831204-73831226 AATCTGCTGGAAGACCTAGAAGG + Intronic
1043475719 8:80603787-80603809 AATCTGATGGAATTCCAACATGG + Intergenic
1048876600 8:138841405-138841427 AAACTGCTTGAAGCCCCACAGGG - Intronic
1049647613 8:143742684-143742706 AACCTGCGGGAAGCTCCAAAGGG + Intergenic
1050718044 9:8552530-8552552 AAGCTGCGAGAAGTCTCCCAGGG - Intronic
1203521405 Un_GL000213v1:49701-49723 CATCTGCAGAAACTCCCACAGGG - Intergenic
1191634626 X:63362651-63362673 AATCTTCAGGAATTGCCACAGGG + Intergenic
1200707877 Y:6458258-6458280 GTTCTGCAGGAAGTCCCACTTGG + Intergenic
1200911177 Y:8532641-8532663 ATTCTGCAGGAAGCCCCACATGG - Intergenic
1200929323 Y:8682978-8683000 GTTCTGCAGGAAGTCCCACAAGG + Intergenic
1200963755 Y:9018185-9018207 GTTCTGCAGGAAGCCCCACATGG + Intergenic
1201026235 Y:9706450-9706472 GTTCTGCAGGAAGTCCCACTTGG - Intergenic
1202149348 Y:21830594-21830616 GTTCTGCAGGAAGCCCCACATGG - Intergenic
1202180691 Y:22137379-22137401 ATTCTGCAGGATGTCCCACCTGG + Intergenic
1202210669 Y:22449021-22449043 ATTCTGCAGGATGTCCCACCTGG - Intergenic