ID: 906144277

View in Genome Browser
Species Human (GRCh38)
Location 1:43550612-43550634
Sequence CCCTCCTAGAACATAACCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 84}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906144277_906144282 10 Left 906144277 1:43550612-43550634 CCCAGGGTTATGTTCTAGGAGGG 0: 1
1: 0
2: 1
3: 8
4: 84
Right 906144282 1:43550645-43550667 TTAATCAAACACCAAAAATGTGG 0: 1
1: 0
2: 1
3: 19
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906144277 Original CRISPR CCCTCCTAGAACATAACCCT GGG (reversed) Intronic
906144277 1:43550612-43550634 CCCTCCTAGAACATAACCCTGGG - Intronic
906459192 1:46024297-46024319 ACCTCCTAGCACCTAATCCTGGG - Intronic
907144350 1:52219085-52219107 CCCAACTATAACATAACCCCTGG + Intronic
908090691 1:60682350-60682372 CCCTTCTAGAACAAAGCGCTGGG + Intergenic
909072266 1:71010071-71010093 CCCTCCTAAAATATATCCCCTGG + Intronic
916183474 1:162108262-162108284 TCCTTCTACAACATGACCCTGGG - Intronic
922700993 1:227760586-227760608 GGCTCCTAGCACATAAGCCTCGG - Intronic
923369562 1:233296403-233296425 CTTTCCTAGAACATAATCCCAGG + Intergenic
1069698641 10:70405759-70405781 CCCTCCTAGATTTTATCCCTTGG - Intronic
1070618133 10:77985215-77985237 GCCTCCATGAACATCACCCTGGG - Exonic
1072533982 10:96345868-96345890 CTCTCCAAGTACAAAACCCTGGG + Exonic
1073087003 10:100898206-100898228 TCCTCCAAGATCCTAACCCTTGG - Intergenic
1074158847 10:110820803-110820825 CCCTTCTAGAACTTTCCCCTTGG - Intronic
1077268876 11:1665905-1665927 GCCTCCTAGGACACAGCCCTGGG - Intergenic
1077271876 11:1685275-1685297 GCCTCCTAGGACACAGCCCTGGG + Intergenic
1080161067 11:29177147-29177169 CCCTTCTAGAAAGTGACCCTAGG + Intergenic
1080433291 11:32217750-32217772 CCCCCCCAGAACATCCCCCTAGG + Intergenic
1084712024 11:70849530-70849552 CTGTACTAGAGCATAACCCTGGG + Intronic
1085851552 11:80126074-80126096 CCCTTCTAAAACATAACAATTGG - Intergenic
1100883218 12:99041087-99041109 CTGTCCAAGAACATAACACTGGG + Intronic
1109956463 13:69573730-69573752 CTCTCCTGTAACACAACCCTCGG - Intergenic
1111123284 13:83880866-83880888 TCCTGCTAGAGGATAACCCTTGG - Exonic
1119263486 14:73251574-73251596 CCTGCCTAGGACCTAACCCTAGG - Intronic
1119631286 14:76234447-76234469 CTCTTCTATAACATAACCATGGG - Intronic
1125516297 15:40323247-40323269 CCCTCCCAGAGGATAAACCTAGG + Intergenic
1126417839 15:48436974-48436996 CCCTGCTAGAATATAACCAAAGG + Exonic
1131596402 15:93802656-93802678 CCCTCCTGGAAATTAACCCCAGG - Intergenic
1137010126 16:35313208-35313230 CTCTCCTCCAACATCACCCTTGG + Intergenic
1143838585 17:9712562-9712584 CTCTCCTGGAACATAGCCCTAGG - Intronic
1144786115 17:17832580-17832602 CCCTCCCAGAACCTCATCCTAGG + Intronic
1146163168 17:30570734-30570756 CCCTCCTAATCCCTAACCCTGGG + Intergenic
1147306598 17:39568588-39568610 CCCTCCAAGAGGATAACCCCTGG + Intergenic
1147580146 17:41623480-41623502 CCCTCCTAATCCCTAACCCTGGG + Intronic
1148824323 17:50381026-50381048 ACCTCCTGGAACACAAGCCTAGG + Exonic
1151387569 17:73764507-73764529 GCCTCCTATAACATCACCATGGG - Intergenic
1151552525 17:74830252-74830274 CCCTCCTGGAACCTCACCCTGGG - Intronic
1152210213 17:78999134-78999156 CACTCCTTGAACCTCACCCTGGG - Intronic
1157433348 18:47649169-47649191 CCTTCCTCCAAGATAACCCTAGG + Intergenic
1159962152 18:74563733-74563755 GCCTCCTAGAAAATAACCCAGGG - Intronic
1165819726 19:38666756-38666778 CCCTCCTAGATCATTATCCCAGG + Intronic
1168186509 19:54703631-54703653 CCCTCAGAAAACATAGCCCTGGG - Intergenic
934522764 2:95030346-95030368 CCCTCCTCCAACAAAACCCAGGG + Intronic
936732041 2:115394355-115394377 ACCTCCAAGAACAGAAACCTGGG - Intronic
940706174 2:157107780-157107802 CCTTCCTGGAACATTACCCCAGG + Intergenic
940801394 2:158136933-158136955 CCCTCCAGGCACATCACCCTTGG + Intergenic
940806372 2:158191952-158191974 CCTTTCTTGAACATAACCTTTGG - Intronic
942092737 2:172509756-172509778 TCCTCTTAGAACATAACCTTGGG + Intergenic
948025235 2:234771247-234771269 CCCTCTTAGAACATCAGCCCCGG - Intergenic
1176613271 21:9006334-9006356 TCTTCCTAGAACCTCACCCTAGG - Intergenic
1179012905 21:37570161-37570183 CCTTCCTAGAACCTACCCCTAGG + Intergenic
1182454916 22:30444094-30444116 CCCTCCCCGAAAATAACCTTTGG - Intergenic
1183205448 22:36415762-36415784 CCATCCTGGAACATACTCCTGGG - Intergenic
949484089 3:4520824-4520846 CCTTCACAGAACAGAACCCTGGG + Intronic
950153572 3:10706976-10706998 GCTTCCTAGAACATTAGCCTTGG - Intronic
954346496 3:50004191-50004213 CCCTTATAGAAGATAACTCTGGG + Intronic
962389021 3:134956329-134956351 CCCTCCCAGGACATAGTCCTTGG + Intronic
962433655 3:135345102-135345124 CCTGCCTAGTACATAACCATTGG + Intergenic
962932706 3:140052543-140052565 CCTTGCTGGATCATAACCCTGGG + Intronic
963052159 3:141151570-141151592 CCCTCCCACAACATAGCACTGGG + Intergenic
963366977 3:144347657-144347679 CCCACTTACAACATAACTCTAGG + Intergenic
965401244 3:168215335-168215357 CTCTCATAGAAAATAACCCAGGG + Intergenic
969494349 4:7517732-7517754 CCCTCCTAGAGCTTAACCCTGGG + Intronic
971007423 4:22390943-22390965 TCATCCTACAACATAACTCTGGG + Intronic
973786568 4:54337871-54337893 CTCTCCTAGAAGCTCACCCTCGG - Intergenic
975253271 4:72204371-72204393 CCCTTCTGGAAAATGACCCTTGG + Intergenic
980020885 4:127708376-127708398 CCCTCCCAGGACATGACCCTGGG + Intronic
985987521 5:3528806-3528828 CCCTCATAAAACATGACCTTGGG - Intergenic
991676348 5:69093128-69093150 CACTCCTAGAAAATTGCCCTGGG + Intergenic
992269542 5:75051597-75051619 CCTTCCTAGAAAACAACCATAGG + Intergenic
996977869 5:129456995-129457017 CTCTCCTAAGTCATAACCCTAGG + Intergenic
997596911 5:135113249-135113271 CCCTCCTATTGCATAACTCTGGG + Intronic
997617158 5:135255326-135255348 CCCTCCGAGGATATTACCCTGGG + Intronic
997630500 5:135364940-135364962 CCCTCCTAGATCATAAATATAGG - Intronic
998611306 5:143692361-143692383 CCCCACTAGAACATAATCTTGGG - Intergenic
999056986 5:148588380-148588402 CCCTCCCAGAATTTAACCTTTGG - Intronic
1008391754 6:50960036-50960058 ACCTCATGGAACATAACCCAGGG - Intergenic
1008604667 6:53128779-53128801 TCCTCCCAGACCATAACTCTTGG + Exonic
1008653206 6:53584750-53584772 GCTTCCTAGAATATATCCCTTGG - Intronic
1011805445 6:91067780-91067802 ACCTCCTAATACATAACCTTGGG - Intergenic
1015194058 6:130506043-130506065 CCCAACTAGAAAATAACCCAAGG + Intergenic
1015384580 6:132607285-132607307 CCCTCCTACAACATAATCCCAGG + Intergenic
1020495752 7:8851390-8851412 CCCTCCTAAACTATAACTCTGGG - Intergenic
1022139448 7:27480630-27480652 CCTTCCTAGTACTTGACCCTTGG - Intergenic
1025007302 7:55364594-55364616 CCCACCAAGAACATGACCATGGG - Intergenic
1028841998 7:95438502-95438524 CACACCAAGAACATAACCCCTGG + Intergenic
1034547055 7:151796109-151796131 CCCTCCTAACACAGAGCCCTAGG + Intronic
1038005246 8:23424357-23424379 CCCTACTAGAACATGAGCCAGGG - Intronic
1044681454 8:94782461-94782483 CCCTCCAAGACCATGACCATAGG + Intronic
1049171972 8:141167092-141167114 CCCTGCTAGACCATAGCCCTCGG - Intronic
1188764620 X:34076345-34076367 CCCTCCTAAATCATTACCTTGGG - Intergenic
1195757462 X:108213480-108213502 CACTCCCACATCATAACCCTTGG - Intronic
1198112478 X:133513946-133513968 CCCTCATAGAATGCAACCCTGGG - Intergenic
1198801839 X:140456011-140456033 TCATCCTAGAGCATCACCCTTGG - Intergenic
1199963286 X:152796707-152796729 CCCTCTTAGTCCATCACCCTGGG - Intergenic